WO2010020494A1 - Neuartiges, universell einsetzbares addiction-system - Google Patents

Neuartiges, universell einsetzbares addiction-system Download PDF

Info

Publication number
WO2010020494A1
WO2010020494A1 PCT/EP2009/059281 EP2009059281W WO2010020494A1 WO 2010020494 A1 WO2010020494 A1 WO 2010020494A1 EP 2009059281 W EP2009059281 W EP 2009059281W WO 2010020494 A1 WO2010020494 A1 WO 2010020494A1
Authority
WO
WIPO (PCT)
Prior art keywords
enzyme
catalyzes
mevalonate
conversion
cell
Prior art date
Application number
PCT/EP2009/059281
Other languages
English (en)
French (fr)
Inventor
Johannes Kaiser
Jens Kroll
Christian Ewering
Alexander Steinbüchel
Original Assignee
Evonik Degussa Gmbh
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Evonik Degussa Gmbh filed Critical Evonik Degussa Gmbh
Publication of WO2010020494A1 publication Critical patent/WO2010020494A1/de

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes

Definitions

  • the invention relates to a genetically modified cell which has at least one altered activity of the enzymes present in the wild-type, so that this cell is able to form a reduced amount of isopentenyl diphosphate compared to its wild-type, characterized in that this cell has at least one increased, in the Wild type non-enzyme activity present, by which this cell is able to form an increased amount of Isopentenyldiphosphat.
  • Addiction systems are z. B. are always used when one or more products are to be produced in cells, for which it is necessary that one or more DNAs (such as a gene, a cDNA) must be stably maintained in the producing cell, without that you have an external selection pressure in the form of z. B. must exercise antibiotics.
  • Known addiction systems for the stable maintenance of foreign DNA in cells provide z.
  • the pTF-FC2 system the doc toxin, Phd antidote, the ColE3 system, and others.
  • An overview of other known bacterial addiction systems are, for example, Urszula Zielenkiewicz and Piotr Cegowski, 2001. Mechanisms of plasmid stable maintenance with special focus on plasmid addiction systems. Acta Biochimica Polonica. 48, 1003-1023.
  • antidote plasmid addiction system (pas) plasmid stability by three genes (pasA, pasB, pasC) gedeci which are located on the plasmid, which encodes one gene for a toxin, the second gene for the antidote and another for an enhancer.
  • the addiction system based on the Doc toxin of the bacteriophage Pl is based on the fact that the Phd protein binds directly to the Doc protein and thus inactivates its toxicity (Gazit E, Sauer RT, 1999.
  • the Doc toxin and Phd antidote proteins of the bacteriophage Pl plasmid addiction system form a heterotrimeric complex. J Biol Chem. 1999 Jun 11; 274 (24): 16813-8).
  • both the genes for the toxins and for the antidotes are encoded on one and the same plasmid in these systems, efficient stabilization of the same is difficult, since loss of the plasmid actually represents an advantage for the cell.
  • a catabolic addiction system is described in 'Voss and Steinbüchel' (Application of a KDPG aldolase gene-dependent addiction system for enhanced production of cyanophycin in Ralstonia eutropha strain Hl ⁇ .Metab Eng. 2006 Jan; 8 (1): 66-78 ).
  • the mechanism of plasmid stabilization is based here on a catabolic utilization of the added sodium gluconate by introducing a single plasmid-encoded copy of the KDPG aldolase gene (eda). Na-gluconate is the only source of carbon in cultivation.
  • the microorganism used can grow chemolithoautotrophically, ie with carbon dioxide as sole carbon source to synthesize all cell components, and is also RecA-positive, it can in this system to mutations during long-term cultivation, thinning of the plasmid and thus ultimately to the loss of the lead cloned gene.
  • Isopentenyl diphosphate isopentenyl pyrophosphate, IPP for short
  • IPP is an essential metabolite that can be synthesized in biological systems in a variety of ways.
  • conversion of the IPP to dimethylallyl diphosphate (DMAPP) occurs, for example via a IPP isomerase takes place; This allows DMAPP and IPP, both isoprenoids, to be in equilibrium together.
  • FIG. 1 shows the methylerythritol phosphate pathway starting from pyruvate and glyceraldehyde-3-phosphate IPP (MEP path, also called DOXP path, mevalonate independent or Rohmer pathway).
  • MEP path also called DOXP path, mevalonate independent or Rohmer pathway.
  • This pathway is in eubacteria, prokaryotes and some unicellular algae, such as Chlamydomonas reinhardtii and in protists such.
  • the MEP pathway is used to form IPP. From this phytol, plastoquinones
  • the mevalonate pathway (MVA pathway), which mostly occurs in higher organisms such as yeasts, mammals, and eukaryotes and some prokaryotes, converts two molecules of acetyl-coenzyme A into IPP in several stages; FIG. 2 shows all intermediate steps and enzymes involved.
  • Methanocaldococcus jannaschii uses a modified mevalonate pathway for biosynthesis of isopentenyl diphosphates J Bacteriol. 2006 May; 188 (9): 3192-8. From the mevalonate-5-phosphate (see Figure 2), isopentenyl monophosphate is obtained via a monophosphomevalonate decarboxylase, which in turn is converted by an isopentenylphosphate kinase to isopentenyl diphosphate.
  • the E. coli strain CGSC #: 8074 carries a deletion in the lytß gene, in the strain is a hybrid plasmid (pBADL), which is a copy of the lytB or ispH
  • pBADL hybrid plasmid
  • this strain is not viable due to lack of IPP synthesis, so the endogenous mutation is complemented by expression of the plasmidally present lytß gene, thus giving only the same enzyme activity as previously was reduced, increased again by an exogenous deployment.
  • the object of the present invention was to provide an alternative addiction system with which the stability of an exogenous nucleic acid in a cell is increased.
  • the genetically modified cell described below which has at least one modified activity of the enzymes present in the wild type, so that this cell is able to form a reduced amount of isopentenyl diphosphate compared to its wild type, characterized in that this cell is at least has an increased, absent in the wild type enzyme activity by which this cell is able to form an increased amount of Isopentenyldiphosphat, contributing to the solution of the above-mentioned objects makes.
  • the cell according to the invention has at least two, more preferably at least three, more preferably at least four and most preferably at least five enhanced enzyme activities not present in the wild type.
  • a nucleic acid which does not contain at least one wild-type, which increases the reduced amount of isopentenyl diphosphate and which has an increased enzyme activity is able to stably remain in the genetically modified cell without selection pressure and continues to be transferred to the next generation.
  • the present invention therefore relates to a genetically modified cell, processes for producing a genetically modified cell and nucleic acids.
  • An advantage of the present invention is the fact that the addiction system according to the invention is not based on a plasmid-based toxin antitoxin system, a catabolic addiction system or an ORT system. Another advantage of the present invention is that the inventive addiction system does not require a resistance marker.
  • Yet another advantage is that with the present invention, an initially mentioned loss of the hybrid plasmid caused by RecA positivity is suppressed.
  • IPP isopentenyl diphosphate
  • isoprenes an interesting metabolite
  • the carbon source can be changed or predetermined for IPP synthesis.
  • cells according to the invention can be produced which contain altered amounts of isoprenoids and terpenoids (such as steroids, flavonoids, gums or carotenoids), monoterpenes, sesquiterpenes, diterpenes, triterpenes, polyterpenes, cyclic monoterpenes, cyclic sesquiterpenes, Cyclic diterpenes, cyclic triterpenes or hormones, fats, oils or vitamins, or their content of soluble sugars, such as. As glucose, fructose and sucrose, as well as to strength is changed. Such cells may in turn be advantageous starting materials for further uses.
  • isoprenoids and terpenoids such as steroids, flavonoids, gums or carotenoids
  • monoterpenes such as steroids, flavonoids, gums or carotenoids
  • sesquiterpenes such as steroids, flavonoids, gums or carotenoids
  • diterpenes such as steroids, flavonoids, gums or caro
  • these cells can be used for the heterologous expression of other genes with the aim of increasing the synthesis of required substances.
  • additional DNA sequences can be introduced and, owing to the addiction system, can be stably maintained without selection pressure (such as, for example, by addition of antibiotics) in the cell according to the invention which encode the enzymes for the synthesis of desired substances.
  • selection pressure such as, for example, by addition of antibiotics
  • the optionally reinforced IPP formed for the synthesis of z.
  • polyketides flavorings, rubber, alkaloids, isoprenoids, polyisoprenoids and for increased posttranlational modification of proteins (prenylated proteins) or prenylation of olefins etc are used.
  • a "wild-type" cell is preferably referred to as a cell whose genome is in a state as naturally produced by evolution, and is used for both the entire cell and for individual genes. fall therefore in particular not such cells or genes whose gene sequences have been at least partially modified by humans by recombinant methods.
  • the cells of the invention may be prokaryotes or eukaryotes. These may be mammalian cells (such as human cells), plant cells or microorganisms such as yeasts, fungi or bacteria.
  • altered activity of the enzymes present in the wild-type is meant both increasing and decreasing an activity of an enzyme which is arbitrarily detectable in the wild-type cell, under the phrase “an increased enzyme activity not present in the wild type” to understand that the wild-type of the genetically modified cell either no or no detectable with the below-mentioned methods enzyme activity, and this non-existing enzyme activity increased after the genetic modification and thus first generated and detectable.
  • altered activity of an enzyme or increased enzyme activity as mentioned above and hereinafter used in connection with the enzymes E1 to E13 is preferably meant altered or increased intracellular activity.
  • the intracellular enzymatic activities can be determined by various methods described (Donahue et al., (2000) Journal of Bacteriology 182 (19): 5624-5627, Ray et al. (2000) Journal of Bacteriology 182 (8): 2277-2284; Freedberg et al. (1973) Journal of Bacteriology 115 (3): 816-823).
  • the activity of a 1-deoxy-D-xylulose-5-phosphate reductoisomerase (EC 1.1.1.267) is preferably determined as described in Takahashi et al.
  • a 1-deoxy-D-xylulose 5-phosphate reductoisomerase catalyzing the formation of 2-C-methyl-D-erythritol 4-phosphate in an alternative nonmevalonate pathway for terpenoid biosynthesis.
  • Proc Natl Acad Be U S A. 1998 Aug 18; 95 (17): 9879-84 Proc Natl Acad Be U S A. 1998 Aug 18; 95 (17): 9879-84.
  • the activity of a 2-C-methyl-D-erythritol-4-phosphate cytidylyltransferase (EC 2.7.7.60) is preferably determined as described in Rohdich et al. Cytidine 5-triphosphate-dependent biosynthesis of isoprenoids: YgbP protein of Escherichia coli catalyzes the formation of 4-diphosphocytidyl-2-C-methylerythritol, Proc. Natl. Acad. Be. U.S.A. 96, 11758-11763.
  • the activity of a 4- (cytidine-5'-diphospho) -2-C-methyl-D-erythritol kinase (EC 2.7.1.148) is preferably determined as described in Bernal et al. A spectrophotometric assay for the determination of 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase activity. Anal Biochem. 2005 May 15; 340 (2): 245-51.
  • the activity of a 2-C-methyl-D-erythritol-2, 4-cyclodiphosphate synthase (EC 4.6.1.12) is preferably determined as described in Herz et al. Biosynthesis of terpenoids: YgbB protein converts 4-diphosphocytidyl-2C-methyl-D-erythritol 2-phosphate to 2C-methyl-D-erythritol 2,4-cyclodiphosphate. Proc Natl Acad Be USA 2000 Mar 14; 97 (6): 2486-90.
  • the activity of an E 5, a 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (EC 1.17.4.3) is preferably determined as described in Hecht et al. Studies on the nonmevalonate pathway to terpenes: the role of the GcpE (IspG) protein. Proc Natl Acad Be USA 2001 Dec 18; 98 (26): 14837-42.
  • the activity of a 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (EC 1.17.1.2) is preferably determined as described in Altincicek et al. LytB protein catalyzes the terminal step of the 2-C-methyl-D-erythritol-4-phosphate pathway of isoprenoid biosynthesis. FEBS Lett. 2002 Dec 18; 532 (3): 437-40.
  • the activity of a hydroxymethylglutaryl-coenzyme A synthase (EC 2.3.3.1.10) is preferably determined as described in Sirinupong et al. Molecular cloning of a new cDNA and expression of 3-hydroxy-3-methylglutaryl-CoA synthase gene from Hevea brasiliensis. Planta. 2005 Jun; 221 (4): 502-12. Epub 2005 Mar 3 described.
  • the activity of a hydroxymethylglutaryl-coenzyme A reductase (EC 1.1.1.34) is preferably determined as described in Hedl et al. Enterococcus faecalis acetoacetyl-coenzymes A thiolase / 3-hydroxy-3-methylglutaryl-coenzyme A reduetase, a dual-function protein of isopentenyl diphosphate biosynthesis. J Bacteriol. 2002 Apr; 184 (8): 2116-22.
  • the activity of a mevalonate kinase (EC 2.7.1.36) is preferably determined as described in Hedl et al. Enterococcus faecalis mevalonate kinase. Protein Be. 2004 Mar; 13 (3): 687-93. Epub 2004 Feb 6 described.
  • the activity of a phosphomevalonate kinase (EC 2.7.4.1) is preferably determined as described in Tzeng et al. The multiple activities of polyphosphate kinase of Escherichia coli and their subunit structure determined by radiation target analysis. J Biol Chem. 2000 Feb 11; 275 (6): 3977-83.
  • the activity of a diphosphomevalonate decarboxylase (EC 4.1.1.33) is preferably determined as described in Lindberg et al. On the mechanism of formation of isopentenyl pyrophosphate. Biochemistry 1 (1962), pp. 182-188.
  • the activity of an isopentenyl phosphate kinase is preferably determined as described in Lange and Croteau isopentenyl diphosphate biosynthesis via a mevalonate-independent pathway: isopentenyl monophosphate kinase catalyzes the terminalenzymatic step (1999).
  • the activity of an isopentenyl diphosphate delta isomerase (EC: 5.3.3.2) is preferably determined as described in Laupitz et al. Biochemical characterization of Bacillus subtilis type II isopentenyl diphosphate isomerase, and phylogenetic distribution of isoprenoid biosynthesis pathways. European Journal of Biochemistry (2004), 271 (13), 2658-2669. described
  • the level of expression for a given enzyme can be used as a measure of activity.
  • the expression of the above and all the enzymes mentioned below can be detected with the aid of 1- and 2-dimensional protein gel separation and subsequent optical identification of the protein concentration with appropriate evaluation software in the gel. If the increase in enzyme activity is based solely on an increase in the expression of the corresponding gene, the quantification of the increase in enzyme activity can be easily determined by comparing the 1- or 2- dimensional protein separations between wild type and genetically engineered cell. A common method for the preparation of the protein gels at z. B. Bacteria and to identify the proteins is that of Hermann et al.
  • an increase in enzymatic activity can be achieved by increasing the copy number of the gene sequence (s) encoding the enzyme, using a strong promoter, or using a gene or allele encoding a corresponding enzyme with enhanced activity and optionally combined these measures.
  • Genetically engineered cells according to the invention are produced for example by transformation, transduction, conjugation or a combination of these methods with a vector which contains the desired gene, an allele of this gene or parts thereof and a vector which enables expression of the gene.
  • the heterologous expression is achieved in particular by the particularly preferred integration according to the invention of the gene or of the alleles into the chromosome of the cell or an extrachromosomally replicating vector.
  • the increase in enzyme activity is accomplished by increasing the expression of an enzyme, for example, one increases the copy number of the corresponding genes or mutates the promoter and regulatory region or the ribosome binding site, which is upstream of the structural gene.
  • expression cassettes act, which are installed upstream of the structural gene.
  • Inducible promoters also make it possible to increase expression at any time.
  • the enzyme gene can be assigned as regulatory sequences but also so-called “enhancers" which also cause an increased gene expression via an improved interaction between RNA polymerase and DNA. By measures to extend the life of the m-RNA is also the Expression improved.
  • enzyme activity is also enhanced.
  • the genes or gene constructs are either present in plasmids with different copy numbers or are integrated and amplified in the chromosome, an integration in the genome being particularly preferred. Alternatively, overexpression of the genes in question by altering the
  • plasmids are those that can be replicated in bacteria, preferably plasmids that have a shuttle function, ie that can potentially be replicated in several organisms.
  • mutations may be undirected either by classical methods can be generated, such as by UV irradiation or by mutagenic chemicals (such as nitrous acid, MNNG / N-methyl-N-nitro-N-nitrosoguanidine, sodium nitrite), or targeted by genetic engineering methods such as deletion (s), insertion (en ) and / or nucleotide exchange (s).
  • mutagenic chemicals such as nitrous acid, MNNG / N-methyl-N-nitro-N-nitrosoguanidine, sodium nitrite
  • genetic engineering methods such as deletion (s), insertion (en ) and / or nucleotide exchange (s).
  • the genetically modified cell is genetically modified in such a way that within a defined time interval, preferably within 2 hours, even more preferably within 8 hours and most preferably within 24 hours, at most half preferably at most one-tenth, moreover preferably at most one hundredth, moreover more preferably at most one-thousandth, and most preferably at most no detectable IPP at all compared to the wild type of the cell, in the event that no enzyme activity not present in the wild-type has been increased .
  • the decrease in the formation of the IPP can be determined, for example, by the cell according to the invention, in which no enzyme activity not present in the wild type was increased, and the wild-type cell each separately under the same conditions (same cell density, same nutrient medium, same culture conditions) a certain time interval are cultivated in a suitable nutrient medium and then the amount of IPP is determined.
  • the cell according to the invention increases by changing at least one activity of the enzymes present in the wild type a reduced amount of isopentenyl diphosphate compared to its wild type by increasing at least one enzyme activity not present in the wild type.
  • the genetically modified cell prefferably be genetically modified in such a way that it is at least one-thousandth, more preferably within 2 hours, even more preferably within 8 hours and most preferably within 24 hours, within a defined time interval preferably at least one hundredth, more preferably at least one tenth, more preferably at least as much and most preferably at least 10 times more IPP than the wild type of the cell.
  • the increase in the formation of the IPP can be determined, for example, by cultivating the cell according to the invention and the wild-type cell separately under the same conditions (same cell density, same nutrient medium, same culture conditions) for a specific time interval in a suitable nutrient medium and then Amount of IPP is determined.
  • this is characterized in that at least one of the enzymes present in the wild-type is selected from the group comprising:
  • An enzyme Ei which catalyzes the conversion of 1-deoxy-D-xylulose-5-phosphate to 2-C-methyl-D-erythritol-4-phosphate
  • an enzyme E 2 which inhibits the conversion of 2-C-methyl- D-erythritol-4-phosphate and cytidine triphosphate catalyses 4- (cytidine-5'-diphospho) -2-C-methyl-D-erythritol
  • an enzyme E 3 which inhibits the conversion of 4- (cytidine-5'-diphospho ) -2-C-methyl-D-erythritol and ATP to 2-phospho-4
  • An enzyme E 7 which catalyzes the conversion of acetoacetyl-coenzyme A to 3-hydroxy-3-methylglutaryl-coenzyme A
  • an enzyme E 8 which catalyzes the conversion of 3-hydroxy-3-methylglutaryl-coenzyme A to mevalonate
  • Enzyme E 9 which catalyzes the conversion of mevalonate to mevalonate-5-phosphate
  • an enzyme Ei 0 which catalyzes the conversion of mevalonate-5-phosphate to mevalonate-5-diphosphate
  • an En enzyme which catalyzes the conversion of mevalonate-5-diphosphate to isopentenyl diphosphate.
  • E 2 is a 2-C-methyl-D-erythritol-4-phosphate
  • E 3 is a 4- (cytidine-5'-diphospho) -2-C-methyl-D-erythritol
  • E 4 is a 2-C-methyl-D-erythritol-2,4-cyclodiphosphate
  • E 5 is a 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase
  • E 6 is a 4-hydroxy-3-methylbut-2-enyl diphosphate reductase
  • E 7 is a hydroxymethylglutaryl-coenzyme A synthase (EC 2.3.3.1.10)
  • E 8 is a hydroxymethylglutaryl-coenzyme A reductase (EC 1.1.1.34),
  • E 9 a mevalonate kinase (EC 2.7.1.36), Eio a phosphomevalonate kinase (EC 2.7.4.1), En a diphosphomevalonate decarboxylase (EC 4.1.1.33),
  • Cell prefers that the cell is capable of IPP synthesis only via the MEP pathway
  • Microorganism preferably selected from the group comprising:
  • those cells are selected which are selected from the group comprising: Lactobacillus, Lactococcus, Escherichia, Staphylococcus, Ralstonia, Bacillus, Corynebacterium, Xanthomonas, Pseudomonas, Streptococcus, Peptostreptococcus, Leuconostoc, Alcanivorax, Agrobacterium, Bifidobacterium, Borellia, Burkholderia, Clostridium, Enterococcus, Fusobacterium, Gluconobacter, Gordonia, Helicobacter, Micrococcus, Mycobacterium, Nocardia,
  • Leuconostoc mesenteroides (subsp. Dextranicum), Azotobacter vinelandii, Azotobacter chroococcum, Alcanivorax borkumensis, Agrobacterium tumefaciens, Bifidobacterium longum, Borrelia burgdorferi, Burkholderia pseudomallei, Clostridium acetobutylicum, propionicum Clostridium, Clostridium pasteurianum, Enterococcus faecalis, Fusobacterium nucleatum, Gluconobacter oxydans, Gordonia westfalica , Gordonia polyisoprenivorans, Helicobacter pylori, Micrococcus luteus, Mycobacterium smegmatis, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Nocardia farcinica, Porphyromonas gingivalis, Pro
  • Chromobacterium violaceum Chromobacterium violaceum, Nitrosomonas europaea, Nitrobacter winogradskyi, Paracoccus denitrificans Thiobacillus ferrooxidans, Desulfovibrio desulfuricans, Streptomyces coelicolor, Streptomyces albulus, Acinetobacter borkumensis and Comamonas testosteroni.
  • Equally preferred representatives of eubacteria are selected from the group comprising all one obligate or facultative phototrophic metabolism possessing proteobacteria, particularly preferred are Rhodospirillum, Rhodobacter, Allochromatium, Chromatium, Synechococcus, Rhodospirillum rubrum, Rhodobacter sphaeroides, Allochromatium vinosum, Chromatium okenii, Synechococcus sp. ,
  • those cells are selected which are selected from the group comprising:
  • Theileria annulata Theileria annulata
  • this is characterized that at least one of the enzymes present in the wild-type is selected from the group comprising:
  • An enzyme E 7 which is the reaction of acetoacetyl-coenzyme
  • A catalyzes 3-hydroxy-3-methylglutaryl-coenzyme A, an enzyme E 8 , which catalyzes the conversion of 3-hydroxy-3
  • Methylglutaryl coenzyme A catalyses mevalonate, an enzyme E 9 that promotes the conversion of mevalonate
  • Mevalonate-5-phosphate catalyses, an enzyme Ei 0 , which inhibits the conversion of mevalonate-5
  • Diphosphate is catalyzed to Isopentenyldiphosphat and the non-wild type enzyme activity is caused by at least one, preferably at least two, more preferably at least three, more preferably at least four, more preferably at least five and most preferably at least six enzymes selected from the group full:
  • E 6 gene product of ispH is E 6 gene product of ispH.
  • the cell is capable of IPP synthesis only via the MVA route
  • Microorganism preferably selected from the group comprising:
  • those cells are preferred, selected from the group comprising:
  • yeasts particular preference is given to those cells selected from the group comprising: Candida pichia Saccharomyces
  • Isopentenyl monophosphate is catalyzed to Isopentenyldiphosphat, and the non-wild type enzyme activity is caused by at least one enzyme selected from the group comprising:
  • Enzyme E 12 or E 13 is true, particularly preferred that for each enzyme E 12 and E 13 is true that
  • E 12 is a monophosphomevalonate decarboxylase
  • E13 is an isopentenyl phosphate kinase.
  • very particularly preferably at least one, preferably both, of the enzymes are:
  • the cell is a microorganism selected from the group of archaea.
  • the archaeon is one selected from the group comprising: Methanocaldococcus janaschii Methanothermobacter thermoautotrophicum Aerchaeoglobus fulgidus, Pyrococcus furiosus Mathanosarcina mazei Sulfolobus solfataricus Aeropyrum pernix
  • Diphosphate catalyses to isopentenyl diphosphate, and the enzyme activity not present in the wild type is caused by at least one enzyme selected from the group comprising:
  • Isopentenyl monophosphate catalyzed to Isopentenyldiphosphat.
  • Enzyme E 12 or E 13 is true, particularly preferred that for each enzyme E 12 and E 13 is true that
  • E 12 is a monophosphomevalonate decarboxylase
  • E13 is an isopentenyl phosphate kinase.
  • At least one, preferably both, of the enzymes is particularly preferred:
  • E 12 is a monophosphome valonate decarboxylase resulting from
  • E13 gene product selected from the group:
  • the cell is a microorganism as described for the above-mentioned second embodiment of the genetically engineered cell, including the preferences set forth
  • the cell may furthermore be advantageous if the cell has at least one altered, preferably increased, activity of an enzyme Ei 4 which catalyzes the conversion of isopentenyl diphosphate to dimethylallyl diphosphate compared to its wild-type.
  • an enzyme Ei 4 which catalyzes the conversion of isopentenyl diphosphate to dimethylallyl diphosphate compared to its wild-type.
  • E i4 isopentenyl diphosphate delta isomerase (EC: 5.3.3.2).
  • egg 4 gene product of an isopentenyl diphosphate delta isomerase gene, which can be isolated from a cell selected from the group comprising:
  • Bacillus cereus (strain ATCC 10987)
  • Bacillus cereus (strain ATCC 14579 / DSM 31)
  • Bacillus cereus (strain ZK / E33L)
  • Chlorobium chlorochromatii (strain CaD3)
  • Chlorobium phaeobacteroides strain DSM 266
  • Cytophaga hutchinsonii strain ATCC 33406 / NCIMB 9469
  • Escherichia coli strain UTI89 / UPEC
  • Escherichia coli O6 K15: H31 (strain 536 / UPEC)
  • Flavobacterium psychrophilum (strain JIP02 / 86 / ATCC 49511)
  • Halo square walsbyl (straln DSM 16790)
  • Halo square walsbyl (straln DSM 16790)
  • Lactobaclllus sakel subsp. sakel (Straln 23K) Lactobacillus salivarius subsp. salivarius (strain UCC118)
  • Lactococcus lactis subsp. cremoris (strain MG1363)
  • Methanobrevibacter smithii strain PS / ATCC 35061 / DSM
  • Methanococcoides burtonii strain DSM 6242
  • Methanococcus aeolicus strain Nankai-3 / ATCC BAA-1280
  • Methanococcus maripaludis Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
  • Methanococcus maripaludis (strain Cl / ATCC BAA-1331)
  • Methanococcus vannielii SB (strain SB / ATCC 35089 / DSM
  • Methanocorpusculum labreanum strain ATCC 43576 / DSM 4855
  • Methanoculleus marisnigri strain ATCC 35101 / DSM 1498 /
  • Methanosaeta thermophila strain DSM 6194 / PT
  • Methanosarcina barkeri strain Fusaro / DSM 804
  • Methanospirillum hungatei strain JF-I / DSM 8644
  • Mycobacterium bovis (strain BCG / Paris 1173P2)
  • Mycobacterium smegmatis (strain ATCC 700084 / mc (2) 155)
  • Myxococcus xanthus (strain DK 1622)
  • Natronomonas pharaonis strain DSM 2160 / ATCC 35678
  • Natronomonas pharaonis strain DSM 2160 / ATCC 35678
  • Natronomonas pharaonis strain DSM 2160 / ATCC 35678
  • Rhizobium etli strain CFN 42 / ATCC 51251
  • Rhodobacter capsulatus
  • Rhodobacter sphaeroides (strain ATCC 17023 / 2.4.1 / NCIB
  • Rhodobacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
  • Rhodobacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
  • Rhodococcus sp. (strain RHAl)
  • Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129) Saccharomyces cerevisiae
  • Saccharopolyspora erythraea (strain NRRL 23338)
  • Saccharopolyspora erythraea (strain NRRL 23338)
  • Salmonella typhi Salmonella typhi
  • Shigella boydii serotype 4 (strain sb227)
  • Shigella dysenteriae serotype 1 (strain Sdl97)
  • Staphylococcus aureus (strain bovine RF122)
  • Staphylococcus aureus (strain COL)
  • Staphylococcus aureus (strain MRSA252)
  • Staphylococcus aureus (strain Mu50 / ATCC 700699)
  • Staphylococcus aureus (strain MW2)
  • Staphylococcus epidermidis (strain ATCC 12228)
  • Staphylococcus epidermidis (strain ATCC 35984 / RP62A) Staphylococcus haemolyticus (strain JCSC1435)
  • Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
  • Streptococcus pneumoniae serotype 2 (strain D39 / NCTC
  • Streptococcus pyogenes serotype M12 (strain MGAS2096)
  • Streptococcus pyogenes serotype M12 (strain MGAS9429)
  • Streptococcus pyogenes serotype M2 (strain MGAS10270)
  • Streptococcus pyogenes serotype M4 (strain MGAS10750)
  • Streptococcus pyogenes serotype M5 strain Manfredo Streptococcus pyogenes serotype M6
  • Streptococcus sanguinis (strain SK36)
  • Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SUC
  • Thermofllum pendens (strain Hrk 5)
  • Thermus thermophll us (s train HB27 / ATCC BAA-1 63 / DSM
  • thermophilus (HB27 strain / ATCC BAA-I 63 / DSM
  • Trichodesmium erythraeum strain IMSlOl
  • Vibrio fischeri strain ATCC 700601 / ES114
  • an addiction system can generally be used to stably obtain one or more further foreign genes in a cell, and thus produce the gene products of the foreign genes, such as occurs in an expression system.
  • the invention thus also relates to a genetically modified cell described above which expresses at least one additional foreign gene.
  • the gene products of the foreign genes can in turn be used by the cell according to the invention to produce further substances.
  • PHA Synthesis Gene Clusters eg, phaC, phaA, phage clusters from, for example, E. eutropha, P. oleovorans, P. aeruginosa, Thiocapsa pfennigii
  • xanthan gum biosynthesis and application a biochemical / genetic perspective
  • xanthan biosynthesis genes and deduced sequences as well as genes for the production of other polysaccharides (eg glycosyltransferase genes), cyanophycin synthesis genes and deduced sequences ( eg cph ⁇ ; cph ⁇ l; cphA2 from eg Synechocystis PCC6208, Anabaena variabilis sp ATCC 29413 Cyanothece sp ATCC 51142; Cyanobacteria; Acinetobacter calcoaceticus; genes coding for insulin (for example into ins from eg homo wax ester synthases and derived sequences (eg, wax ester synthase / acyl-CoA: diacylglycerol acyltransferase ws / dgate from, for example, Acinetobacter calcoaceticus ADPl or Myco
  • a further contribution to the solution of the abovementioned objects is made by a process for the production of a genetically modified cell, comprising the process steps A) lowering the activity of at least one of the enzymes already present in the wild-type egg to E 6 and B) increasing at least one preferably at least two preferably at least three, more preferably at least four, and most preferably at least five of the non-wild-type enzyme activities of E 7 to En.
  • the increase in enzyme activities is achieved by introducing at least one exogenous nucleic acid into the cell; This exogenous nucleic acid is able to stably remain in the genetically modified cell without selection pressure and continues to be transferred to the next generation.
  • this exogenous nucleic acid is integrated into the genome of the cell or is introduced into the cell in the form of an expression vector.
  • Microorganism preferably selected from the group comprising:
  • eubacteria are those cells selected from the group comprising: Lactobacillus, Lactococcus, Escherichia, Staphylococcus, Ralstonia, Bacillus, Corynebacterium, Xanthomonas, Pseudomonas, Streptococcus, Peptostreptococcus, Leuconostoc, Alcanivorax, Agrobacterium, Bifidobacterium, Borellia, Burkholderia, Clostridium , Enterococcus, Fusobacterium, Gluconobacter, Gordonia, Helicobacter, Micrococcus, Mycobacterium, Nocardia,
  • Leuconostoc mesenteroides (subsp. Dextranicum), Azotobacter vinelandii, Azotobacter chroococcum, Alcanivorax borkumensis, Agrobacterium tumefaciens, Bifidobacterium longum, Borrelia burgdorferi, Burkholderia pseudomallei, Clostridium acetobutylicum, propionicum Clostridium, Clostridium pasteurianum, Enterococcus faecalis, Fusobacterium nucleatum, Gluconobacter oxydans, Gordonia westfalica , Gordonia polyisoprenivorans, Helicobacter pylori, Micrococcus luteus, Mycobacterium smegmatis, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Nocardia farcinica, Porphyromonas gingivalis, Pro
  • Equally preferred representatives of eubacteria are selected from the group comprising all one obligate or facultative phototrophic metabolism possessing proteobacteria, particularly preferred are Rhodospirillum, Rhodobacter, Allochromatium, Chromatium, Synechococcus, Rhodospirillum rubrum, Rhodobacter sphaeroides, Allochromatium vinosum, Chromatium okenii, Synechococcus sp.
  • those cells are selected which are selected from the group comprising:
  • Theileria annulata Theileria annulata
  • a method for producing delta mvaKl:: ispC-H provides a method for producing a genetically modified cell, comprising the steps A) lowering the activity of at least one of the already present in the wild-type enzymes E 7 to En and B) Increasing at least one preferably at least two, more preferably at least three, more preferably at least four, more preferably at least five, and most preferably at least six of the non-wild type enzyme activities of egg to E 6 .
  • the increase in enzyme activities is achieved by introducing at least one exogenous nucleic acid into the cell; this exogenous nucleic acid is able without Selection pressure stable in the genetically modified
  • Nucleic acid is integrated into the genome of the cell or is introduced into the cell in the form of an expression vector.
  • the cell is capable of IPP synthesis only via the MVA route
  • Microorganism preferably selected from the group comprising:
  • fungi particularly preferred are those cells selected from the group comprising: Absidia agaricus Ajellomyces
  • yeasts in particular those cells are preferred, selected from the group comprising:
  • the term "product" means any substance which is increasingly synthesized by the cell according to the invention as a result of the genetic modification in comparison to its wild type. These may therefore be, for example, intermediates of the IPP metabolic pathways, gene products of the foreign genes, but also by the gene products of foreign genes synthesized substances such. B. the cyanophycin described below.
  • a method according to the invention for the production of products comprises the step of contacting a cell according to the invention with a nutrient medium comprising a carbon source under conditions under which product is formed, and optionally purifying the product from the culture.
  • the genetically modified cells according to the invention can be used continuously or discontinuously in the batch process (batch cultivation) or in the fed-batch process (Feed method) or repeated-fed-batch method (repetitive feed method) for the purpose of production with the nutrient medium in contact and thus cultivated. Also conceivable is a semi-continuous process, as described in GB-A-1009370.
  • a summary of known cultivation methods are in the textbook by Chmiel ("Bioprocess 1. Introduction to Bioprocess Engineering” (Gustav Fischer Verlag, Stuttgart, 1991)) or in the textbook by Storhas ("Bioreactors and Peripheral Facilities", Vieweg Verlag, Braunschweig / Wiesbaden, 1994).
  • the culture medium to be used must suitably satisfy the requirements of the respective strains. Descriptions of culture media of various microorganisms are contained in the Manual of Methods for General Bacteriology of the American Society for Bacteriology (Washington D.C, USA, 1981).
  • carbohydrates such as glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose, oils and fats such.
  • soybean oil, sunflower oil, peanut oil and coconut oil fatty acids such.
  • palmitic acid, stearic acid and linoleic acid alcohols such.
  • glycerol and methanol hydrocarbons such as methane, amino acids such as L-glutamate or L-valine or organic acids such.
  • chemolitho-autotroph-growing microorganisms such as Ralstonia eutropha or photo-autotroph-growing microorganisms such as Rhodobacter sphaeroides used. These substances can be used individually or as a mixture. Further preferred is the use of complex medium constituents of residues of Agricultural products. Particular preference is given to the use of carbohydrates, in particular monosaccharides, oligosaccharides or polysaccharides, as described in US Pat. Nos. 6,01,494 and 6,136,576, of C5 sugars or of glycerol.
  • nitrogen source organic nitrogen-containing compounds such as peptones, yeast extract, meat extract, malt extract, corn steep liquor, soybean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate or N2 in nitrogen-fixing microorganisms z.
  • organic nitrogen-containing compounds such as peptones, yeast extract, meat extract, malt extract, corn steep liquor, soybean meal and urea
  • inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate or N2 in nitrogen-fixing microorganisms z.
  • Rhizobium leguminosarum or cyanobacteria can be used.
  • the nitrogen sources can be used singly or as a mixture.
  • phosphorus source can phosphoric acid
  • the culture medium must continue to contain salts of metals such. As magnesium sulfate or iron sulfate, which are necessary for growth. Finally, essential growth factors such as amino acids and vitamins can be used in addition to the above-mentioned substances.
  • suitable precursors can be added to the culture medium. The said feedstocks may be added to the culture in the form of a one-time batch or fed in a suitable manner during the cultivation.
  • basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or ammonia water or acidic compounds such as phosphoric acid or sulfuric acid or carbonic acid used in a suitable manner.
  • acidic compounds such as phosphoric acid or sulfuric acid or carbonic acid used in a suitable manner.
  • B. fatty acid polyglycol ester or vegetable oil can be used.
  • Other common methods of process control and foam control systems for fermentation processes can be found in the relevant literature.
  • the medium suitable selective substances such as B. antibiotics are added.
  • oxygen or oxygen-containing gas mixtures such. As air, registered in the culture.
  • the temperature of the culture is normally from 20 ° C. to 45 ° C., and preferably from 25 ° C.
  • the cells which can convert glycerol as substrate, it may be preferable to use such cells as cells, which are described in US 6,803,218.
  • the cells can be cultured at temperatures in the range of 40 to 100 0 C.
  • the cells may, if the product is not secreted into the culture medium, be disrupted and the product recovered from the lysate by known purification procedures.
  • the cells can, for example, by high-frequency ultrasound, by high pressure, such. B. in a French pressure cell, by osmolysis, by the action of detergents, lytic enzymes or organic solvents, by homogenizers or by combining several of the listed methods are digested.
  • the purification of the product can be achieved by known chromatographic methods, such as For example, tangential filtration, precipitation, distillation, molecular sieve chromatography (gel filtration), Q-sepharose chromatography, Ionenausauseh-chromatography, affinity chromatography, hydrophobic chromatography, as well as other conventional methods such as ultrafiltration, crystallization, salting out, dialysis and native gel electrophoresis.
  • chromatographic methods such as For example, tangential filtration, precipitation, distillation, molecular sieve chromatography (gel filtration), Q-sepharose chromatography, Ionenausauseh-chromatography, affinity chromatography, hydrophobic chromatography, as well as other conventional methods such as ultrafiltration, crystallization, salting out, dialysis and native gel electrophoresis.
  • products of Processes with Cells According to the Invention Also part of the invention are products prepared by the process of the invention for the preparation of products described above.
  • the product is selected from the group comprising
  • Isoprenoids and terpenoids such as steroids, flavonoids, gums or carotenoids
  • monoterpenes sesquiterpenes
  • diterpenes triterpenes
  • polyterpenes cyclic monoterpenes
  • cyclic sesquiterpenes cyclic diterpenes
  • cyclic triterpenes hormones, fats, oils or vitamins and the gene product of the foreign gene
  • FIG. 1 The MEP path
  • FIG. 2 The MVA path
  • FIG. 3 Cultivation of E. coli HMS174 (DE3) pColaDuet
  • FIG. 4 Plasmid map pCOLADuet-1:: MVAl-5:: cphA
  • FIG. 5 foreign gene expression
  • pCOLADuet-1 MVAl -5, SEQ ID NO: 3, initially two plasmids, pCOLADuet-1 :: MVA-top, SEQ ID NO: 1, and pCOLADuet-1 :: MVA-bottom, SEQ ID NO: 2, synthesized by BioBasic Inc., Ontario, Canada.
  • Both plasmids were digested with Kpnl / Mfel; the resulting 2103 base pair fragment from pCOLADuet 1:: MVA bottom was ligated into the 8321 base pair fragment from pCOLADuet-1:: MVA-top to give pCOLADuet-1:: MVAl-5.
  • E. coli HMS174 (DE3) pColaDuet-1:: MVAl-5 The strain thus generated is hereinafter referred to as "E. coli HMS174 (DE3) pColaDuet-1:: MVAl-5 ".
  • E. coli HMS174 (DE3) AispH ⁇ FRT / Amp / FRT pColaDuet-1:: MVAl-5 ".
  • the control experiment was carried out with E. coli HMS174 (DE3) without pCOLADuet-1 :: MVAl-5.
  • a selection of the resulting clones was plated for MVA1-5 on kanamycin (Km) / ampicillin (Amp) LB plates and for the control without MVA1-5 on Amp LB plates.
  • the control did not show any vital colonies that would have resulted from non-lethal integration of FRT / Amp / FRT integration into the ispH gene.
  • coli HMS174 (DE3) AispH ⁇ FRT / Amp / FRT pColaDuet-1:: MVAl-5 showed approximately 320 colony-forming units (cfu) with the same plated-out amount of cells from the regeneration batch. Numerous experiments showed that the ampicillin resistance was genomically correctly integrated and permanently preserved.
  • the recombinant strains of E. coli used were inoculated with 1% of a 12-hour pre-culture (LB medium with corresponding antibiotics: rifampicin for E. coli HMS174 (DE3) + kanamycin for pColaDuet-1 and optionally ampicillin for genomic insertion fragment) and in a 4- fold chicane Klett flask (250 mL total volume with 100ml of LB medium) at 37 0 C and 180 rpm cultured.
  • the optical density measurement was made from the chicane Velcro piston directly with a Klett Summerson colorimeter.
  • the cells were diluted uniformly with sterile saline (NaCl 0.9% in H 2 O) and plated out in equal volumes on LB and LB selection plates (with 50 ⁇ g kanamycin). After incubation at 37 0 C for 24 h, the counting of the colony ⁇ forming units (cfu) was charged with respect to the occurred colony.
  • sterile saline NaCl 0.9% in H 2 O
  • T7 cyanophycin synthase (cphA6308C595S) transcription unit was functionally cloned into the plasmid pCOLADuet-1:: MVAl-5 as an exemplary foreign gene a purified template plasmid, pET23a :: cphA6308C5956S, comprising a DNA coding for cyanophycin synthetase with NCBI accession number: AAF43647 containing an amino acid modification [C595S] was amplified by means of the 5 'primer pET23aXhoIT7_fw (5'-AACTCGAGATTAATACGACTCACTATAGG-3 s ) and the 3 s primer "T7 terminator" ⁇ '-GCTAGTTATTGCTCAGCGG-S'a cph ⁇ 6308
  • the approach includes: 10 ⁇ l primer 5 ⁇ l 10 ⁇ l primer 3 ⁇ l 10 ⁇ l dNTP-MIX (2.5 mM each), 10 ⁇ l 10-fold Pfx amplification buffer (Invitrogen), 2.5 ⁇ l MgSO 4 (50 mM), 10 ⁇ l (2 ng) Template DNA (pET23a: cphA6308), 0.5 ⁇ l of Platinum® Pfx DNA polymerase (from Invitrogen), ad 100 ⁇ l of H 2 O bidist.
  • the PCR product was purified using the GeneClean kit from Qiagen (QIAquick Gel Extraction Kit) according to the enclosed instructions for use. Subsequently, the purified PCR product was digested by means of restriction enzyme Xhol (Fa. Fermentas) according to the instructions of the instruction for 12 h at 37 ° C and the enzyme was inactivated at 80 0 C for 15 min. For ligation, this digested fragment was ligated into the Xhol-digested and linearized target vector pCOLADuet-1 :: MVAl-5 as follows. According to the equation of DUGAICZYK et al.
  • the concentration of the vector (j) to be used can be calculated in the ligation batch, in which the initial theoretical rate of bimolecular linkage reaction and intramolecular cyclization is the same.
  • j (ng / ml) 51.1 x Mr-O, 5 x 1000
  • the DNA fragment to be ligated was ligated with the 2-4-fold molar excess of vectorial DNA.
  • the ligation approach consisted of the DNA species to be ligated and the supplied ligase buffer in a final concentration of 1 ⁇ . 1 ug DNA was used for the ligation of cohesive ends 1 U. The reaction was carried out overnight at a temperature of 14.5 0 C in a Peltier thermoblock (HLC).
  • Transformation of pColaDuet-1:: MVAl-5:: cphA in E. coli The plasmid was transformed into strain E. coli HMS174 (DE3). This recombinant strain was the starting point for the following ispH knockout and is referred to hereafter as "E. coli HMS174 (DE3) pColaDuet-1:: MVA1-5: cphA ".
  • E. coli HMS174 (DE3) pColaDuet-1:: MVAl-5.
  • the stem thus generated is hereinafter referred to as "E. coli HMS174 (DE3) AispH ⁇ FRT / Amp / FRT pColaDuet-1:: MVAl-5: cphA ".
  • the expression of the foreign gene can be determined by the synthesis of cyanophycin. This is clearly indicated by the white color of expressing bacteria.
  • Figure 5 shows white, opaque bacterial colonies of E. coli HMS174 (DE3) AispH ⁇ FRT / Amp / FRT pColaDuet-1:: MVAl-5 :: cphA. Cyanophycin is therefore an example of a substance synthesized by the gene product of a foreign gene.
  • E. coli HMS174 (DE3) pColaDuet-1:: MVAl-5 :: cphA and E. coli HMS174 (DE3) AispH ⁇ FRT / Amp / FRT pColaDuet-1 : MVAl-5:: cphA) were inoculated with 1% of a 12-hour pre-culture (LB medium with corresponding antibiotics: rifampicin for E.
  • the table given here shows mean values of the comparative, quantitative determination of the plasmid loss after 70 h in LB medium without antibiotics:

Abstract

Gegenstand der Erfindung ist eine gentechnisch veränderte Zelle, die mindestens eine geänderte Aktivität der im Wildtyp vorhandenen Enzyme aufweist, so dass diese Zelle eine im Vergleich zu ihrem Wildtyp reduzierte Menge an Isopentenyldiphosphat zu bilden vermag, dadurch gekennzeichnet, dass diese Zelle mindestens eine gesteigerte, im Wildtyp nicht vorhandene Enzymaktivität aufweist, durch die diese Zelle eine erhöhte Menge an Isopentenyldiphosphat zu bilden vermag.

Description

Neuartiges, universell einsetzbares addiction-System
Gebiet der Erfindung
Gegenstand der Erfindung ist eine gentechnisch veränderte Zelle, die mindestens eine geänderte Aktivität der im Wildtyp vorhandenen Enzyme aufweist, so dass diese Zelle eine im Vergleich zu ihrem Wildtyp reduzierte Menge an Isopentenyldiphosphat zu bilden vermag, dadurch gekennzeichnet, dass diese Zelle mindestens eine gesteigerte, im Wildtyp nicht vorhandene Enzymaktivität aufweist, durch die diese Zelle eine erhöhte Menge an Isopentenyldiphosphat zu bilden vermag.
Stand der Technik
Bekannte addiction-Systeme
Addiction-Systeme werden z. B. immer dann eingesetzt, wenn in Zellen ein oder mehrere Produkte hergestellt werden sollen, für die es nötig ist, dass eine oder mehrere DNAs (wie z. B. ein Gen, eine cDNA) stabil in der produzierenden Zelle aufrechterhalten werden muss, ohne dass man einen externen Selektionsdruck in Form von z. B. Antibiotika ausüben muss.
Bekannte addiction-Systeme zur stabilen Aufrechterhaltung von Fremd-DNA in Zellen stellen z. B. das pTF-FC2 System, das Doc-Toxin, Phd Antidote, das ColE3 System und weitere dar. Eine Übersicht über weitere bekannte bakterielle addiction-Systeme sind beispielsweise Urszula Zielenkiewicz and Piotr Cegowski, 2001. Mechanisms of plasmid stable maintenance with special focus on plasmid addiction systems. Acta Biochimica Polonica. 48, 1003-1023 zu entnehmen .
Allen bekannten addiction-Systemen ist gemein, dass es sich um katabole, toxin-antitoxin- oder Operator Repressor Titrations („ORT"; siehe Cranenburg et al . 2001, Escherichia coli strains that allow antibiotic-free plasmid selection and maintenance by repressor titration) - Systeme handelt. Diese Systeme haben die Eigenschaft, sich aufgrund des nachlassenden Selektionsdrucks (z. B. Metabolisierung bzw. Spaltung der Antibiotika, Bindung des Toxins durch das Antidot) im Verlauf einer Kultivierung aus dem System wieder heraus zu selektieren, da sie gegenüber stoffwechselaktiveren Zellen benachteiligt sind, die einen niedrigeren metabolischen Aufwand und somit weniger Energie aufwenden müssen. Dies führt schnell dazu, dass sich nur noch die Zellen durchsetzen und vermehren werden, die gar kein Plasmid mit den gewünschten Eigenschaften enthalten. Bei dem pTF-FC2 proteic poison-antidote plasmid addiction System (pas) wird die Plasmidstabilität durch drei Gene (pasA, pasB, pasC) gewährleistet, die auf dem Plasmid lokalisiert sind, wobei das eine Gen für ein Toxin, das zweite Gen für das Antidot und ein weiteres für einen Enhancer kodiert. Dieses System ermöglicht jedoch lediglich eine 3fache Stabilisierung des Plasmids (Smith AS, Rawlings DE, 1997. The poison-antidote stability System of the broad-hostrange Thiobacillus ferrooxidans plasmid pTF-FC2. Mol Microbiol. Dec; 26 (5) : 961-70) .
Das addiction-System auf Basis des Doc-Toxins des Bakteriophagen Pl beruht darauf, dass das Phd-Protein direkt an das Doc-Protein bindet und somit dessen Toxizität inaktiviert (Gazit E, Sauer RT, 1999. The Doc toxin and Phd antidote proteins of the bacteriophage Pl plasmid addiction System form a heterotrimeric complex. J Biol Chem. 1999 Jun 11; 274 (24) : 16813-8) . Da aber bei diesen Systemen sowohl die Gene für die Toxine, als auch für die Antidote auf ein und demselben Plasmid kodiert vorliegen, ist eine effiziente Stabilisierung desselben schwierig, da ein Verlust des Plasmids eigentlich einen Vorteil für die Zelle darstellt .
Ein kataboles addiction-System ist in 'Voss and Steinbüchel' beschrieben (Application of a KDPG-aldolase gene-dependent addiction System for enhanced production of cyanophycin in Ralstonia eutropha strain Hlβ.Metab Eng. 2006 Jan; 8 (1) : 66-78) . Der Mechanismus der Plasmidstabilisierung beruht hier auf einer katabolen Verwertung des zugefütterten Natrium-Gluconats durch Einbringen einer singulären plasmidkodierten Kopie des KDPG-Aldolase-Gens (eda) . Wobei Na-Gluconat in der Kultivierung die einzige Kohlenstoffquelle darstellt. Da der eingesetzte Mikroorganismus jedoch chemolithoautotroph wachsen kann, das heißt mit Kohlendioxid als einziger Kohlenstoffquelle alle Zellbestandteile zu synthetisieren vermag, und zudem RecA-positiv ist, kann es in diesem Sytstem zu Mutationen während einer Langzeitkultivierung, zum Ausdünnen des Plasmids und somit letztendlich zum Verlust des klonierten Gens führen.
Isopentenyldiphosphat (Isopentenylpyrophosphat, kurz IPP) ist ein essentieller Metabolit, der in biologischen Systemen auf verschiedenen Wegen synthetisiert werden kann. Oft findet eine Umwandlung des IPPs zu Dimethylallyldiphosphat (DMAPP) , beispielsweise über eine IPP-Isomerase statt; dadurch können DMAPP und IPP, beides Isoprenoide, gemeinsam im Gleichgewicht vorliegen.
MEP-Weg
Figur 1 zeigt den ausgehend von Pyruvat und Glycerinaldehyd-3-Phosphat IPP bereitstellenden Methylerythritolphospat-Stoffwechselweg (MEP-Weg, auch DOXP-Weg, Mevalonat unabhängiger oder Rohmer-Weg genannt) auf. Dieser Weg ist in Eubakterien, Prokaryoten und einigen einzelligen Algen, beispielsweise Chlamydomonas reinhardtii und in Protisten wie z. B. Plasmodium falciparum (KEGGG- Datenbank, Acta Biochim Pol. Isoprenoid biosynthesis via 1- deoxy-D-xylulose 5-phosphate/2-C-methyl-D-erythritol 4- phosphate (DOXP/MEP) pathway. Wanke et al . 2001) oder Theileria annulata , Theileria parva beschrieben worden. Auch wird in den Chloroplasten höherer Pflanzen der MEP-Weg zur Bildung von IPP genutzt. Hieraus wird für die Photosynthese notwendiges Phytol, Plastochinone oder Carotenoide synthetisiert.
MVA Weg
Der zumeist in höheren Organismen wie Hefen, Säugern, und Eukaryoten und einigen Prokaryonten vorkommende Mevalonat- Weg (MVA-Weg) setzt über mehrere Stufen zwei Moleküle Acetyl-CoenzymA zu IPP um; Figur 2 zeigt alle Zwischenschritte und involvierte Enzyme auf.
Al terna ti ve MVA Weg
Ein alternativer MVA Weg wurde beschrieben in Grochowski et al . Methanocaldococcus jannaschii uses a modified mevalonate pathway for biosynthesis of isopentenyl diphosphate J Bacteriol. 2006 May; 188 ( 9) : 3192-8. Ab dem Mevalonat-5-Phosphat (vgl. Figur 2) wird über eine Monophosphomevalonat-Decarboxylase Isopentenylmonophosphat erhalten, welches wiederum durch eine Isopentenylphosphat- Kinase zu Isopentenyldiphosphat umgesetzt wird.
Bekannte IPP defiziente Stämme und Komplimentierung Aus der Literatur sind Bakterienstämme mit defekter IPP Synthese bekannt, so z. B. aus McAteer, S., A. Coulson, N. F. McLennan, M. Masters 2001. The lytB gene of Escherichia coli is essential and specifies a product needed for isoprenoid biosynthesis . J. Bacteriol. 183:7403- 7407 und aus Franci X et al . 2000. Evidence of a RoIe for LytB in the Nonmevalonate Pathway of Isoprenoid Biosynthesis. J. Bacteriol .182 : 5841-5848.
Im „The Coli Genetic Stock Center" der YaIe Universität der E. coli Stamm CGSC#:8074 hinterlegt, der eine Deletion im lytß-Gen trägt. In dem Stamm liegt ein Hybridplasmid (pBADL) vor, welches eine Kopie des lytB bzw. ispH-Gens enthält. Bei nicht induziertem Promotor (Arabinose- Induktion) ist dieser Stamm aufgrund IPP-Synthese-Mangels nicht lebensfähig. Die endogene Mutation wird somit durch Expression des plasmoidal vorliegenden lytß-Gens komplementiert. Somit wird hier lediglich exakt dieselbe Enzymaktivität, die zuvor reduziert wurde, durch eine exogene Bereitstellung wieder erhöht.
Bekannter Transfer von kompletten MEP oder MVA Wegen in andere Wirte, die nicht IPP defizient sind
US2007166782 Keasling Jay D. et. al . 2007 beschreibt eine Methode, zusätzliches IPP in der Zelle durch Einbringen von Genen des MVA-Weges bzw. des gesamten MVA-Weges bereitzustellen. Die modifizierten Zellen sind selber bereits in der Lage, IPP über alternative Routen zu synthetisieren .
Aufgabe der vorliegenden Erfindung war es, ein alternatives addiction-System bereitzustellen, mit dem die Stabilität einer exogenen Nukleinsäure in einer Zelle erhöht wird.
Beschreibung der Erfindung
Überraschenderweise wurde gefunden, dass die im Folgenden beschriebene gentechnisch veränderte Zelle, die mindestens eine geänderte Aktivität der im Wildtyp vorhandenen Enzyme aufweist, so dass diese Zelle eine im Vergleich zu ihrem Wildtyp reduzierte Menge an Isopentenyldiphosphat zu bilden vermag, dadurch gekennzeichnet, dass diese Zelle mindestens eine gesteigerte, im Wildtyp nicht vorhandene Enzymaktivität aufweist, durch die diese Zelle eine erhöhte Menge an Isopentenyldiphosphat zu bilden vermag, einen Beitrag zur Lösung der eingangs genannten Aufgaben leistet. Bevorzugt weist erfindungsgemäße Zelle mindestens zwei, weiter bevorzugt mindestens drei, darüber hinaus weiter bevorzugt mindestens vier und am meisten bevorzugt mindestens fünf gesteigerte, im Wildtyp nicht vorhandene Enzymaktivitäten auf.
Eine für mindestens eine im Wildtyp nicht vorhandene, die reduzierte Menge an Isopentenyldiphosphat erhöhende und gesteigerte Enzymaktivität kodierende Nukleinsäure vermag ohne Selektionsdruck stabil in der gentechnisch veränderten Zelle zu verweilen und wird weiterhin in die nächste Generation übertragen. Gegenstand der vorliegenden Erfindung sind daher eine gentechnisch veränderte Zelle, Verfahren zur Herstellung einer gentechnisch veränderten Zelle und Nukleinsäuren.
Ein Vorteil der vorliegenden Erfindung ist die Tatsache, dass das erfindungsgemäße addiction-System nicht auf einem plasmidbasierten Toxin-Antitoxin-System, einem katabolen addiction Sytem oder einem ORT-System basiert. Ein weiterer Vorteil der vorliegenden Erfindung ist, dass das erfindungsgemäße addiction-System ohne Resistenzmarker auskommt .
Noch ein weiterer Vorteil ist, dass mit der hier vorliegenden Erfindung ein eingangs erwähnter, aufgrund von RecA-Positivität verursachter Verlust des Hybridplasmids unterbunden ist.
Ein weiterer Vorteil der vorliegenden Erfindung ist, dass das addiction-System auf Stoffwechselwegen basiert, die Isopentenyldiphosphat (Isopentenylpyrophosphat, kurz IPP), synthetisieren: IPP ist z. B. als Vorstufe von Isoprenen ein interessanter Metabolit, und mit der vorliegenden Erfindung kann zusätzlich in einer gegebenen Zelle die Kohlenstoffquelle zur IPP-Synthese geändert bzw. vorgegeben werden .
Noch ein weiterer Vorteil der vorliegenden Erfindung ist, dass es zur verstärkten Synthese von IPP und somit zur verstärkten Bildung von Terpenoiden kommen kann. Insbesondere können erfindungsgemäße Zellen hergestellt werden, die veränderte Mengen an Isoprenoiden und Terpenoiden (wie beispielsweise Steroide, Flavonoide, Gummistoffe oder Carotenoide) , Monoterpenen, Sesquiterpenen, Diterpenen, Triterpenen, Polyterpenen, Cyclischen Monoterpenen, Cyclischen Sesquiterpenen, Cyclischen Diterpenen, Cyclischen Triterpenen oder auch Hormonen, Fetten, Ölen oder Vitaminen aufweisen, oder deren Gehalt an löslichen Zuckern, wie z. B. Glucose, Fructose und Saccharose, sowie an Stärke verändert ist. Derartige Zellen können wiederum vorteilhafte Ausgangsstoffe für weitere Verwendungen sein. Beispielsweise können diese Zellen zur heterologen Expression weiterer Gene mit dem Ziel der verstärkten Synthese von benötigten Substanzen dienen. So können etwa zusätzlich DNA-Sequenzen eingeführt und aufgrund des addiction-Systems stabil ohne Selektionsdruck (wie z. B. durch Antibiotikazugabe) in der erfindungsgemäßen Zelle aufrechterhalten werden, die die Enzyme zur Synthese von gewünschten Substanzen kodieren. Auf diese Weise kann das gegebenenfalls verstärkt gebildete IPP zur Synthese von z. B. Polyketiden, Aromastoffen, Kautschuk, Alkaloiden, Isoprenoiden, Polyisoprenoiden und zur verstärkten posttranlationalen Modifikation von Proteinen (prenylierte Proteine) oder Prenylierung von Olefinen etc genutzt werden.
Wildtyp
Unter einem „Wildtyp" einer Zelle wird vorzugsweise eine Zelle bezeichnet, deren Genom in einem Zustand vorliegt, wie er natürlicherweise durch die Evolution entstanden ist. Der Begriff wird sowohl für die gesamte Zelle als auch für einzelne Gene verwendet. Unter den Begriff „Wildtyp" fallen daher insbesondere nicht solche Zellen bzw. solche Gene, deren Gensequenzen zumindest teilweise durch den Menschen mittels rekombinanter Verfahren verändert worden sind. Die erfindungsgemäßen Zellen können Prokaryonten oder Eukaryonten sein. Dabei kann es sich um Säugetierzellen (wie etwa Zellen aus dem Menschen) , um pflanzliche Zellen oder um Mikroorganismen wie Hefen, Pilze oder Bakterien handeln .
Enzymaktivität und Aktivität von Enzymen so wie deren Änderung
Unter der Formulierung „geänderte Aktivität der im Wildtyp vorhandenen Enzyme" sind sowohl Erhöhung als auch Erniedrigung einer Aktivität eines Enzyms, welches in der Wildtyp-Zelle beliebig nachweisbar ist, zu verstehen. Unter der Formulierung „eine gesteigerte, im Wildtyp nicht vorhandene Enzymaktivität" ist zu verstehen, dass der Wildtyp der gentechnisch veränderten Zelle entweder keine oder keine mit unten aufgeführten Methoden nachweisbare Enzymaktivität aufweist, und diese nicht vorhandene Enzymaktivität nach der gentechnischen Veränderung gesteigert und somit erst erzeugt und nachweisbar wird. Unter „geänderte Aktivität eines Enzyms oder gesteigerte Enzymaktivität" , wie vorstehend erwähnt und nachfolgenden im Zusammenhang mit den Enzymen Ei bis Ei3 verwendet, ist vorzugsweise geänderte oder gesteigerte intrazelluläre Aktivität zu verstehen.
Die nun folgenden Ausführungen zum „Ändern , Erhöhen , Erniedrigen und Steigern einer Aktivität eines Enzyms oder einer Enzymaktivität" gelten für alle in diesem Text genannten Enzyme und Enzymaktivitäten, deren Aktivität gegebenenfalls geändert, erhöht, erniedrigt oder gesteigert werden kann.
Die intrazellulären enzymatischen Aktivitäten können nach verschiedenen beschriebenen Methoden (Donahue et al . (2000) Journal of Bacteriology 182 (19) : 5624-5627; Ray et al . (2000) Journal of Bacteriology 182 (8) : 2277-2284; Freedberg et al . (1973) Journal of Bacteriology 115 (3) : 816-823) bestimmt werden.
Die Aktivität einer l-Deoxy-D-Xylulose-5-Phosphate- Reductoisomerase (EC 1.1.1.267) wird bevorzugt bestimmt, wie in Takahashi et al . A 1-deoxy-D-xylulose 5-phosphate reductoisomerase catalyzing the formation of 2-C-methyl-D- erythritol 4-phosphate in an alternative nonmevalonate pathway for terpenoid biosynthesis . Proc Natl Acad Sei U S A. 1998 Aug 18; 95 (17) : 9879-84 beschrieben. Die Aktivität einer 2-C-Methyl-D-Erythritol-4-Phosphat- Cytidylyltransferase (EC 2.7.7.60) wird bevorzugt bestimmt, wie in Rohdich et al . Cytidine 5-triphosphate-dependent biosynthesis of isoprenoids: YgbP protein of Escherichia coli catalyzes the formation of 4-diphosphocytidyl-2-C- methylerythritol, Proc. Natl. Acad. Sei. U. S. A. 96, 11758- 11763 beschrieben.
Die Aktivität einer 4- (Cytidin-5 ' -Diphospho) -2-C-Methyl-D- Erythritol-Kinase (EC 2.7.1.148) wird bevorzugt bestimmt, wie in Bernal et al . A spectrophotometric assay for the determination of 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase activity. Anal Biochem. 2005 May 15; 340 (2) : 245-51 beschrieben .
Die Aktivität einer 2-C-Methyl-D-Erythritol-2, 4- Cyclodiphosphat-Synthase (EC 4.6.1.12) wird bevorzugt bestimmt, wie in Herz et al . Biosynthesis of terpenoids: YgbB protein converts 4-diphosphocytidyl-2C-methyl-D- erythritol 2-phosphate to 2C-methyl-D-erythritol 2,4- cyclodiphosphate. Proc Natl Acad Sei U S A. 2000 Mar 14; 97 (6) :2486-90 beschrieben. Die Aktivität einer E5 eine 4-Hydroxy-3-Methylbut-2-en-l- yl-Diphosphat-Synthase (EC 1.17.4.3) wird bevorzugt bestimmt, wie in Hecht et al . Studies on the nonmevalonate pathway to terpenes: the role of the GcpE (IspG) protein. Proc Natl Acad Sei U S A. 2001 Dec 18; 98 (26) : 14837-42 beschrieben .
Die Aktivität einer 4-Hydroxy-3-Methylbut-2-enyl- Diphosphat-Reductase (EC 1.17.1.2) wird bevorzugt bestimmt, wie in Altincicek et al . LytB protein catalyzes the terminal Step of the 2-C-methyl-D-erythritol-4-phosphate pathway of isoprenoid biosynthesis . FEBS Lett. 2002 Dec 18; 532 (3) :437-40 beschrieben.
Die Aktivität einer Hydroxymethylglutaryl-Coenzym A- Synthase (EC 2.3.3.1.10) wird bevorzugt bestimmt, wie in Sirinupong et al . Molecular cloning of a new cDNA and expression of 3-hydroxy-3-methylglutaryl-CoA synthase gene from Hevea brasiliensis . Planta. 2005 Jun; 221 (4) : 502-12. Epub 2005 Mar 3 beschrieben.
Die Aktivität einer Hydroxymethylglutaryl-Coenzym A- Reduktase (EC 1.1.1.34) wird bevorzugt bestimmt, wie in Hedl et al . Enterococcus faecalis acetoacetyl-coenzyme A thiolase/3-hydroxy-3-methylglutaryl-coenzyme A reduetase, a dual-function protein of isopentenyl diphosphate biosynthesis. J Bacteriol. 2002 Apr; 184 (8) : 2116-22 beschrieben .
Die Aktivität einer Mevalonat-Kinase (EC 2.7.1.36) wird bevorzugt bestimmt, wie in Hedl et al . Enterococcus faecalis mevalonate kinase. Protein Sei. 2004 Mar;13 (3) : 687-93. Epub 2004 Feb 6 beschrieben. Die Aktivität einer Phosphomevalonat-Kinase (EC 2.7.4.1) wird bevorzugt bestimmt, wie in Tzeng et al . The multiple activities of polyphosphate kinase of Escherichia coli and their subunit structure determined by radiation target analysis. J Biol Chem. 2000 Feb 11 ; 275 ( 6) : 3977- 83.beschrieben .
Die Aktivität einer Diphosphomevalonat-Decarboxylase (EC 4.1.1.33) wird bevorzugt bestimmt, wie in Lindberg et al . On the mechanism of formation of isopentenylpyrophosphate . Biochemistry 1 (1962), pp . 182-188 beschrieben. Die Aktivität einer Isopentenylphosphat-Kinase wird bevorzugt bestimmt, wie in Lange and Croteau Isopentenyl diphosphate biosynthesis via a mevalonate-independent pathway: Isopentenyl monophosphate kinase katalyzes the terminalenzymatic Step (1999) beschrieben.
Die Aktivität einer Isopentenyldiphosphat-delta-Isomerase (EC:5.3.3.2) wird bevorzugt bestimmt, wie in Laupitz et al . Biochemical characterization of Bacillus subtilis type II isopentenyl diphosphate isomerase, and phylogenetic distribution of isoprenoid biosynthesis pathways . European Journal of Biochemistry (2004), 271(13), 2658-2669. beschrieben
Da die Aktivität von Enzymen in einer Zelle mit der Menge an Enzym korreliert, kann für ein gegebenes Enzym der Expressionslevel als Maß für die Aktivität herangezogen werden. Die Expression der vorstehend und aller nachfolgend genannten Enzyme ist mit Hilfe von 1- und 2-dimensionaler Proteingelauftrennung und anschließender optischer Identifizierung der Proteinkonzentration mit entsprechender Auswertesoftware im Gel nachweisbar. Wenn die Erhöhung einer Enzymaktivität ausschließlich auf einer Erhöhung der Expression des entsprechenden Gens basiert, so kann die Quantifizierung der Erhöhung der Enzymaktivität in einfacher Weise durch einen Vergleich der 1- oder 2- dimensionalen Proteinauftrennungen zwischen Wildtyp und gentechnisch veränderter Zelle bestimmt werden. Eine gebräuchliche Methode zur Präparation der Proteingele bei z. B. Bakterien und zur Identifizierung der Proteine ist die von Hermann et al . (Electrophoresis, 22: 1712.23 (2001) beschriebene Vorgehensweise. Die Proteinkonzentration kann ebenfalls durch Western-Blot-Hybridisierung mit einem für das nachzuweisende Protein spezifischen Antikörper (Sambrook et al . , Molecular Cloning: a laboratory manual, 2nd Ed. CoId Spring Harbor Laboratory Press, CoId Spring Harbor, N. Y. USA, 1989) und anschließender optische Auswertung mit entsprechender Software zur Konzentrationsbestimmung (Lohaus und Meyer (1989) Biospektrum, 5: 32-39; Lottspeich (1999), Angewandte Chemie 111: 2630-2647) analysiert werden. Sofern in den vorangegangenen oder nachfolgenden Ausführungen keine konkreten Methoden zur Bestimmung der Aktivität eines bestimmten Enzyms angegeben werden, erfolgt die Bestimmung der Steigerung der Enzymaktivität und auch die Bestimmung der Verminderung einer Enzymaktivität vorzugsweise mittels der in Hermann et al . , Electophoresis, 22: 1712-23 (2001), Lohaus et al . , Biospektrum 5 32- 39 (1998), Lottspeich, Angewandte Chemie 111: 2630- 2647 (1999) und Wilson et al . , Journal of Bacteriology 183: 2151-2155 (2001) beschriebenen Methoden.
Grundsätzlich lässt sich eine Steigerung der enzymatischen Aktivität dadurch erzielen, dass man die Kopienzahl der Gensequenz bzw. der Gensequenzen erhöht, welche für das Enzym kodieren, einen starken Promotor verwendet oder ein Gen oder Allel nutzt, das für ein entsprechendes Enzym mit einer gesteigerten Aktivität kodiert und gegebenenfalls diese Maßnahmen kombiniert. Erfindungsgemäß gentechnisch veränderte Zellen werden beispielsweise durch Transformation, Transduktion, Konjugation oder einer Kombination dieser Methoden mit einem Vektor erzeugt, der das gewünschte Gen, ein Allel dieses Gens oder Teile davon und einen die Expression des Gens ermöglichenden Vektor enthält. Die heterologe Expression wird insbesondere durch die erfindungsgemäß besonders bevorzugte Integration des Gens oder der Allele in das Chromosom der Zelle oder einem extrachromosomal replizierenden Vektor erzielt. Einen Überblick über die Möglichkeiten zur Erhöhung der Enzym-Aktivität in Zellen am Beispiel der Pyruvat- Carboxylase gibt DE-A-100 31 999, die hiermit als Referenz eingeführt wird und deren Offenbarungsgehalt hinsichtlich der Möglichkeiten zur Erhöhung der Enzym-Aktivität in Zellen einen Teil der Offenbarung der vorliegenden Erfindung bildet.
Wird die Erhöhung der Enzymaktivität durch Erhöhung der Expression eines Enzyms bewerkstelligt, so erhöht man beispielsweise die Kopienzahl der entsprechenden Gene oder mutiert die Promotor- und Regulationsregion oder die Ribosomenbindungsstelle, die sich stromaufwärts des Strukturgens befindet. In gleicher Weise wirken Expressionskassetten, die stromaufwärts des Strukturgens eingebaut werden. Durch induzierbare Promotoren ist es zusätzlich möglich, die Expression zu jedem beliebigen Zeitpunkt zu steigern. Des Weiteren können dem Enzym-Gen als regulatorische Sequenzen aber auch sogenannte "Enhancer" zugeordnet sein, die über eine verbesserte Wechselwirkung zwischen RNA-Polymerase und DNA ebenfalls eine erhöhte Genexpression bewirken. Durch Maßnahmen zur Verlängerung der Lebensdauer der m-RNA wird ebenfalls die Expression verbessert. Weiterhin wird durch Verhinderung des Abbaus des Enzymproteins ebenfalls die Enzymaktivität verstärkt. Die Gene oder Genkonstrukte liegen dabei entweder in Plasmiden mit unterschiedlicher Kopienzahl vor oder sind im Chromosom integriert und amplifiziert, wobei eine Integration im Genom besonders bevorzugt ist. Alternativ kann weiterhin eine Überexpression der betreffenden Gene durch Veränderung der
Medienzusammensetzung und Kulturführung erreicht werden. Anleitungen hierzu findet der Fachmann unter anderem bei Martin et al . (Bio/Technology 5, 137-146 (1987)), bei Guerrero et al . (Gene 138, 35-41 (1994)), Tsuchiya und Morinaga (Bio/Technology 6, 428-430 (1988)), bei Eikmanns et al. (Gene 102, 93-98 (1991)), in EP-A-O 472 869, im US 4,601,893, bei Schwarzer und Pühler (Bio/Technology 9, 84-87 (1991), bei Reinscheid et al . (Applied and Environmental Microbiology 60, 126-132 (1994)), bei LaBarre et al. (Journal of Bacteriology 175, 1001-1007 (1993)), in WO-A-96/15246, bei Malumbres et al . (Gene 134, 15-24 (1993), in JP-A-10-229891, bei Jensen und Hammer (Biotechnology and Bioengineering 58, 191-195 (1998)) und in bekannten Lehrbüchern der Genetik und Molekularbiologie. Zur Erhöhung der Expression der jeweiligen Gene werden zum Beispiel episomale Plasmide eingesetzt. Als Plasmide eignen sich beispielsweise solche, die in Bakterien repliziert werden können. Bevorzugt werden solche Plasmide eingesetzt, die eine Shuttle-Funktion aufweisen, d. h. potenziell in mehreren Organismen repliziert werden können.
Wird die Änderung der Enzymaktivität durch Mutation des endogenen Gens bewerkstelligt, so können derartige Mutationen entweder nach klassischen Methoden ungerichtet erzeugt werden, wie etwa durch UV-Bestrahlung oder durch mutationsauslösende Chemikalien (wie z.B salpetrige Säure, MNNG/N-Methyl-N-nitro-N-nitrosoguanidin, Natriumnitrit) , oder gezielt mittels gentechnologischer Methoden wie Deletion (en) , Insertion (en) und/oder Nukleotidaustausch (e) . Durch diese Mutationen werden gentechnisch veränderte Zellen erhalten. Hierdurch können beispielsweise auch Enzymaktivitäten generiert werden, die im Vergleich zur Wildtyp-Enzymaktivität vermindert oder vermehrt feedback- inhibierbar sind.
Zur Erniedrigung einer Enzymaktivität in einer Zelle sind dem Fachmann verschieden Techniken, wie beispielsweise gerichteter Knockout, Gendeletionen, Zufallsmutagenese oder Verwendung von spezifischen Inhibitoren geläufig. Es können auch induzierbare bzw. konditionale Knockout-Systeme generiert werden, wie z. B. in McAteer et al . (J" Bacteriol . 2001 Dec; 183 (24) : 7403-7) beschrieben. Ein ebenfalls einsetzbares und mittlerweile verbreitetes Mittel zur Herabregulierung von Genen ist der Einsatz von antisense- Nukleinsäuren wie beispielsweise siRNAs (small interfering RNAs) . Weitere Beispiele für antisense-Nukleinsäuren verwendende Systeme kann der Fachmann z. B. bei Zaratiequi et al. (Cell. 2007 Feb 23; 128 (4) : 763-76) , Scherr et al . (Cell Cycle. 2007 Feb 1 ; 6 (4) : 444-9) und Sahu et al . (Curr Pharm Biotechnol. 2007 Oct ; 8 (5) : 291-304) und in bekannten Lehrbüchern der Genetik und Molekularbiologie nachschlagen.
„Durch Änderung mindestens einer Aktivität der im Wildtyp vorhandenen Enzyme eine im Vergleich zu ihrem Wildtyp reduzierte Menge an Isopentenyldiphosphat" Gemäß oben beschriebener Ausführungsform bildet erfindungsgemäße Zelle in dem Fall, dass keine im Wildtyp nicht vorhandenen Enzymaktivität erhöht wurde, durch Änderung mindestens einer Aktivität der im Wildtyp vorhandenen Enzyme eine im Vergleich zu ihrem Wildtyp reduzierte Menge an Isopentenyldiphosphat . Dabei ist es erfindungsgemäß bevorzugt, dass die gentechnisch veränderte Zelle derart gentechnisch verändert ist, dass sie in einem definierten Zeitintervall, vorzugsweise innerhalb von 2 Stunden, noch mehr bevorzugt innerhalb von 8 Stunden und am meisten bevorzugt innerhalb von 24 Stunden, höchstens die Hälfte, besonders bevorzugt höchstens ein Zehntel, darüber hinaus bevorzugt höchstens ein hundertstel, darüber hinaus noch mehr bevorzugt höchstens ein Tausendstel und am meisten bevorzugt höchstens gar kein nachweisbares IPP verglichen zu dem Wildtyp der Zelle bildet, in dem Fall, dass keine im Wildtyp nicht vorhandenen Enzymaktivität erhöht wurde. Die Abnahme der Bildung des IPPs kann dabei beispielsweise dadurch bestimmt werden, dass die erfindungsgemäße Zelle, bei der keine im Wildtyp nicht vorhandenen Enzymaktivität erhöht wurde, und die Wildtyp- Zelle jeweils getrennt unter gleichen Bedingungen (gleiche Zelldichte, gleiches Nährmedium, gleiche Kulturbedingungen) für ein bestimmtes Zeitintervall in einem geeigneten Nährmedium kultiviert werden und anschließend die Menge an IPP bestimmt wird.
„Erhöhung der reduzierten Menge an Isopentenyldiphosphat durch Steigerung mindestens einer im Wildtyp nicht vorhandenen Enzymaktivität" Des Weiteren erhöht gemäß oben beschriebener Ausführungsform erfindungsgemäße Zelle durch Änderung mindestens einer Aktivität der im Wildtyp vorhandenen Enzyme eine im Vergleich zu ihrem Wildtyp reduzierte Menge an Isopentenyldiphosphat durch Steigerung mindestens einer im Wildtyp nicht vorhandenen Enzymaktivität . Dabei ist es erfindungsgemäß bevorzugt, dass die gentechnisch veränderte Zelle derart gentechnisch verändert ist, dass sie in einem definierten Zeitintervall, vorzugsweise innerhalb von 2 Stunden, noch mehr bevorzugt innerhalb von 8 Stunden und am meisten bevorzugt innerhalb von 24 Stunden, mindestens ein Tausendstel, besonders bevorzugt mindestens ein Hundertstel, darüber hinaus bevorzugt mindestens ein Zehntel, darüber hinaus noch mehr bevorzugt mindestens genauso viel und am meisten bevorzugt mindestens 10 mal mehr IPP bildet als der Wildtyp der Zelle. Die Zunahme der Bildung des IPPs kann dabei beispielsweise dadurch bestimmt werden, dass die erfindungsgemäße Zelle und die Wildtyp-Zelle jeweils getrennt unter gleichen Bedingungen (gleiche Zelldichte, gleiches Nährmedium, gleiche Kulturbedingungen) für ein bestimmtes Zeitintervall in einem geeigneten Nährmedium kultiviert werden und anschließend die Menge an IPP bestimmt wird.
Ersetzen der IPP Synthese durch MEP gegen IPP Synthese durch MVA
Gemäß einer ersten Ausführungsform der erfindungsgemäßen Zelle ist diese dadurch gekennzeichnet, dass mindestens eines der im Wildtyp vorhandenen Enzyme ausgewählt ist aus der Gruppe umfassend:
IS Ein Enzym Ei, welches die Umsetzung von 1-Deoxy-D-Xylulose- 5-Phosphat zu 2-C-Methyl-D-Erythritol-4-Phosphat katalysiert, ein Enzym E2, welches die Umsetzung von 2-C-Methyl-D- Erythritol-4-Phosρhat und Cytidintriphosphat zu 4- (Cytidin- 5' -Diphospho) -2-C-Methyl-D-Erythritol katalysiert, ein Enzym E3, welches die Umsetzung von 4- (Cytidin-5' - Diphospho) -2-C-Methyl-D-Erythritol und ATP zu 2-Phospho-4-
(Cytidin-5' -Diphospho) -2-C-Methyl-D-Erythritol katalysiert, ein Enzym E4, welches die Umsetzung von 2-Phospho-4-
(Cytidin-5' -Diphospho) -2-C-Methyl-D-Erythritol zu 2-C- Methyl-D-Erythritol-2, 4-Cyclodiphosphat katalysiert, ein Enzym E5, welches die Umsetzung von 2-C-Methyl-D- Erythritol-2, 4-Cyclodiphosphat zu (E) -4-Hydroxy-3- Methylbut-2-enyldiphosphat katalysiert und ein Enzym E6, welches die Umsetzung von (E) -4-Hydroxy-3- Methylbut-2-enyldiphosphat zu IPP und/oder DMAPP katalysiert und die im Wildtyp nicht vorhandene Enzymaktivität hervorgerufen wird durch mindestens ein, bevorzugt mindestens zwei, weiter bevorzugt mindestens drei, darüber hinaus weiter bevorzugt mindestens vier und am meisten bevorzugt mindestens fünf Enzyme ausgewählt aus der Gruppe umfassend:
Ein Enzym E7, welches die Umsetzung von Acetoacetyl-Coenzym A zu 3-Hydroxy-3-Methylglutaryl-Coenzym A katalysiert, ein Enzym E8 , welches die Umsetzung von 3-Hydroxy-3- Methylglutaryl-Coenzym A zu Mevalonat katalysiert, ein Enzym E9, welches die Umsetzung von Mevalonat zu Mevalonat-5-Phosphat katalysiert, ein Enzym Ei0, welches die Umsetzung von Mevalonat-5- Phosphat zu Mevalonat-5-Diphosphat katalysiert und ein Enzym En, welches die Umsetzung von Mevalonat-5- Diphosphat zu Isopentenyldiphosphat katalysiert.
Im Rahmen der gesamten Erfindung ist bevorzugt, dass für mindestens eines der Enzyme Ei bis En zutrifft, besonders bevorzugt, dass für jedes Enzym Ei bis En zutrifft, dass
Ei eine l-Deoxy-D-Xylulose-5-Phosphate-Reductoisomerase (EC
1.1.1.267) ,
E2 eine 2-C-Methyl-D-Erythritol-4-Phosphat-
Cytidylyltransferase (EC 2.7.7.60),
E3 eine 4- (Cytidin-5 ' -Diphospho) -2-C-Methyl-D-Erythritol-
Kinase (EC 2.7.1.148) ,
E4 eine 2-C-Methyl-D-Erythritol-2, 4-Cyclodiphosphat-
Synthase (EC 4.6.1.12) ,
E5 eine 4-Hydroxy-3-Methylbut-2-en-l-yl-Diphosphat-Synthase
(EC 1.17.4.3) , E6 eine 4-Hydroxy-3-Methylbut-2-enyl-Diphosphat-Reductase
(EC 1.17.1.2) ,
E7 eine Hydroxymethylglutaryl-Coenzym A-Synthase (EC 2.3.3.1.10) ,
E8 eine Hydroxymethylglutaryl-Coenzym A-Reduktase (EC 1.1.1.34) ,
E9 eine Mevalonat-Kinase (EC 2.7.1.36), Eio eine Phosphomevalonat-Kinase (EC 2.7.4.1), En eine Diphosphomevalonat-Decarboxylase (EC 4.1.1.33),
In dieser ersten Ausführungsform erfindungsgemäßer Zelle ist ganz besonders bevorzugt mindestens eines, bevorzugt mindestens zwei, weiter bevorzugt mindestens drei, darüber hinaus weiter bevorzugt mindestens vier, darüber hinaus weiter bevorzugt mindestens fünf und am meisten bevorzugt mindestens sechs der Enzyme: E6 Genprodukt des ispH,
E7 Genprodukt des mvaS aus Staphylococcus aureus ,
E8 Genprodukt des mvaÄ aus Lactobacillus lactis oder aus
Staphylococcus aureus,
E9 Genprodukt des mvaKl aus Staphylococcus aureus,
Eio Genprodukt des mvaK2 aus Staphylococcus aureus und
En Genprodukt des mvaD aus Staphylococcus aureus.
In dieser Ausführungsform erfindungsgemäßer Zelle ist am meisten bevorzugt:
E6 Genprodukt des IspH
E7 Genprodukt des mvaS aus Staphylococcus aureus,
E8 Genprodukt des mvaA aus Lactobacillus lactis und aus
Staphylococcus aureus,
E9 Genprodukt des mvaKl aus Staphylococcus aureus,
Eio Genprodukt des mvaK2 aus Staphylococcus aureus und
En Genprodukt des mvaD aus Staphylococcus aureus.
Weiterhin ist es im Zusammenhang mit dem vorstehend beschriebenen Ausführungsform der gentechnisch veränderten
Zelle bevorzugt, dass es sich bei der Zelle um einen nur über den MEP-Weg zur IPP-Synthese befähigten
Mikroorganismus, bevorzugt ausgewählt aus der Gruppe umfassend:
Eubakterien,
Piastiden von Apicomplexa und Piastiden höherer Pflanzen handelt .
Unter den Eubakterien sind insbesondere diejenigen Zellen bevorzugt, ausgewählt aus der Gruppe umfassend: Lactobacillus , Lactococcus , Escherichia, Staphylococcus , Ralstonia , Bacillus , Corynebacterium, Xanthomonas , Pseudomonas, Streptococcus , Peptostreptococcus , Leuconostoc, Alcanivorax, Agrobacterium, Bifidobacterium, Borellia, Burkholderia, Clostridium, Enterococcus , Fusobacterium, Gluconobacter, Gordonia, Helicobacter, Micrococcus , Mycobacterium, Nocardia,
Porphyromonas , Propionibacterium, Rhizobium, Rhodococcus , Salmonella, Zymomonas , Vibrio, Myxococcus , Chromobacterium, Nitrosomonas , Citrobacter, Paracoccus , Thiobacillus , Desulfovibrio, Streptomyces , Acinetobacter, Comamonas , Escherichia coli, Lactococcuss lactis, Lactobacillus brevis , S aureus Ralstonia eutropha , Ralstonia solanacearum, Ralstonia metallidurans , Bacillus subtilis , Bacillus cereus , Bacillus megaterium, Bacillus anthracis , Bacillus liehen!formes , Bacillus thuringiensis , Corynebacterium glutamicum, Xanthomonas campestris , Pseudomonas putida, Pseudomonas oleovorans , Pseudomonas aeruginosa , Pseudomonas fluoreszens , Streptococcus salivarius , Staphylococcus aureus, Staphylococcus epidermidis , Peptostreptococcus sp . , Leuconostoc mesenteroides (subsp. dextranicum) , Azotobacter vinelandii, Azotobacter chroococcum, Alcanivorax borkumensis , Agrobacterium turnefaciens , Bifidobacterium longum, Borellia burgdorferi , Burkholderia pseudomallei , Clostridium acetobutylicum, Clostridium propionicum, Clostridium pasteurianum, Enterococcus faecalis , Fusobacterium nucleatum, Gluconobacter oxydans , Gordonia westfalica, Gordonia polyisoprenivorans , Helicobacter pylori, Micrococcus luteus , Mycobacterium smegmatis , Mycobacterium bovis , Mycobacterium leprae, Mycobacterium tubercolosis , Nocardia farcinica , Porphyromonas gingivalis , Propionibacterium freudenreichii , Rhizobium leguminosarum, Rhodococcus opacus , Salmonella enterica , Salmonella typhimurium, Zymomonas mobilis , Vibrio fisheri , Vibrio cholerae, Myxococcus sp . , Chromobacterium violaceum, Nitrosomonas europaea , Nitrobacter winogradskyi , Paracoccus denitrificans Thiobacillus ferrooxidans , Desulfovibrio desulfuricans , Streptomyces coelicolor, Streptomyces albulus , Acinetobacter borkumensis und Comamonas testosteroni .
Ebenso bevorzugte Vertreter von Eubakterien sind ausgewählt aus der Gruppe umfassend alle einen obligat oder fakultativ phototrophen Stoffwechsel besitzenden Proteobakterien, besonders bevorzugt sind hier Rhodospirillum, Rhodobacter, Allochromatium, Chromatium, Synechococcus , Rhodospirillum rubrum, Rhodobacter sphaeroides , Allochromatium vinosum, Chromatium okenii, Synechococcus sp..
Unter den Apicomplexa sind insbesondere diejenigen Zellen bevorzugt, ausgewählt aus der Gruppe umfassend:
Plasmodium,
Paramecium,
Tetrahymena,
Chlamydomonas reinhardtii
Theileria annulata,
Theileria parva
Ersetzen der IPP Synthese durch MVA gegen IPP Synthese durch MEP
Gemäß einer zweiten Ausführungsform der erfindungsgemäßen Zelle ist diese dadurch gekennzeichnet, dass mindestens eines der im Wildtyp vorhandenen Enzyme ausgewählt ist aus der Gruppe umfassend:
Ein Enzym E7, welches die Umsetzung von Acetoacetyl-Coenzym
A zu 3-Hydroxy-3-Methylglutaryl-Coenzym A katalysiert, ein Enzym E8 , welches die Umsetzung von 3-Hydroxy-3-
Methylglutaryl-Coenzym A zu Mevalonat katalysiert, ein Enzym E9, welches die Umsetzung von Mevalonat zu
Mevalonat-5-Phosphat katalysiert, ein Enzym Ei0, welches die Umsetzung von Mevalonat-5-
Phosphat zu Mevalonat-5-Diphosphat katalysiert und ein Enzym En, welches die Umsetzung von Mevalonat-5-
Diphosphat zu Isopentenyldiphosphat katalysiert und die im Wildtyp nicht vorhandene Enzymaktivität hervorgerufen wird durch mindestens ein, bevorzugt mindestens zwei, weiter bevorzugt mindestens drei, darüber hinaus weiter bevorzugt mindestens vier, darüber hinaus weiter bevorzugt mindestens fünf und am meisten bevorzugt mindestens sechs Enzyme ausgewählt aus der Gruppe umfassend:
Ein Enzym Ei, welches die Umsetzung von 1-Deoxy-D-Xylulose-
5-Phosphat zu 2-C-Methyl-D-Erythritol-4-Phosphat katalysiert, ein Enzym E2, welches die Umsetzung von 2-C-Methyl-D-
Erythritol-4-Phosρhat und Cytidintriphosphat zu 4- (Cytidin-
5' -Diphospho) -2-C-Methyl-D-Erythritol katalysiert, ein Enzym E3, welches die Umsetzung von 4- (Cytidin-5' -
Diphospho) -2-C-Methyl-D-Erythritol und ATP zu 2-Phospho-4-
(Cytidin-5' -Diphospho) -2-C-Methyl-D-Erythritol katalysiert, ein Enzym E4, welches die Umsetzung von 2-Phospho-4-
(Cytidin-5' -Diphospho) -2-C-Methyl-D-Erythritol zu 2-C- Methyl-D-Erythritol-2, 4-Cyclodiphosphat katalysiert, ein Enzym E5, welches die Umsetzung von 2-C-Methyl-D- Erythritol-2, 4-Cyclodiphosphat zu (E) -4-Hydroxy-3- Methylbut-2-enyldiphosphat katalysiert und ein Enzym E6, welches die Umsetzung von (E) -4-Hydroxy-3- Methylbut-2-enyldiphosphat zu IPP und/oder DMAPP katalysiert .
In dieser zweiten Ausführungsform erfindungsgemäßer Zelle ist ganz besonders bevorzugt mindestens eines, bevorzugt mindestens zwei, weiter bevorzugt mindestens drei, darüber hinaus weiter bevorzugt mindestens vier, darüber hinaus weiter bevorzugt mindestens fünf, darüber hinaus weiter bevorzugt mindestens sechs und am meisten bevorzugt mindestens sieben der Enzyme:
Eio Genprodukt des mvaKl,
Ei Genprodukt des ispC,
E2 Genprodukt des ispD,
E3 Genprodukt des ispE,
E4 Genprodukt des ispF,
E5 Genprodukt des ispG und
E6 Genprodukt des ispH.
In dieser Ausführungsform erfindungsgemäßer Zelle ist am meisten bevorzugt:
Eio Genprodukt des mvaKl,
Ei Genprodukt des ispC,
E2 Genprodukt des ispD,
E3 Genprodukt des ispE,
E4 Genprodukt des ispF,
E5 Genprodukt des ispG und
E6 Genprodukt des ispH. Weiterhin ist es im Zusammenhang mit der vorstehend beschriebenen zweiten Ausführungsform der gentechnisch veränderten Zelle bevorzugt, dass es sich bei der Zelle um einen nur über den MVA-Weg zur IPP-Synthese befähigten
Mikroorganismus, bevorzugt ausgewählt aus der Gruppe umfassend:
Hefen,
Pilze, handelt .
Unter den Pilzen sind insbesondere diejenigen Zellen bevorzugt, ausgewählt aus der Gruppe umfassend:
Absidia
Agaricus
Aj ellomyces
Arthroderma
Acremonium
Aspergillus
Disporotrichum
Geosmithia
Mortierella
Paecilomyces
Penicillium
Rhizopus
Trichoderma
Talaromyces
Thielavia .
Unter den Hefen sind insbesondere diejenigen Zellen bevorzugt, ausgewählt aus der Gruppe umfassend: Candida Pichia Saccharomyces
Arxula
Klyveromyces
Yarrowia
Hansenula
Brettanomyces
Ersetzen der IPP Synthese durch „MVA alternativ" gegen IPP
Synthese durch „MVA"
Gemäß einer dritten Ausführungsform der erfindungsgemäßen
Zelle ist diese dadurch gekennzeichnet, dass mindestens eines der im Wildtyp vorhandenen Enzyme ausgewählt ist aus der Gruppe umfassend:
Ein Enzym E12, welches die Umsetzung von Mevalonat-5-
Phosphat zu Isopentenylmonophosphat katalysiert und ein Enzym E13, welches die Umsetzung von
Isopentenylmonophosphat zu Isopentenyldiphosphat katalysiert, und die im Wildtyp nicht vorhandene Enzymaktivität hervorgerufen wird durch mindestens ein Enzym ausgewählt aus der Gruppe umfassend:
Ein Enzym E10, welches die Umsetzung von Mevalonat-5-
Phosphat zu Mevalonat-5-Diphosphat katalysiert und ein Enzym En, welches die Umsetzung von Mevalonat-5-
Diphosphat zu Isopentenyldiphosphat katalysiert.
Dabei ist es bevorzugt, dass für mindestens eines der
Enzyme E12 oder E13 zutrifft, besonders bevorzugt, dass für jedes Enzym E12 und E13 zutrifft, dass
E12 eine Monophosphomevalonat-Decarboxylase,
E13 eine Isopentenylphosphat-Kinase ist . In dieser dritten Ausführungsform erfindungsgemäßer Zelle ist ganz besonders bevorzugt mindestens eines, bevorzugt beide der Enzyme:
Eio Genprodukt des mvaK2 aus Staphylococcus aureus und En Genprodukt des mvaD aus Staphylococcus aureus.
Weiterhin ist es im Zusammenhang mit dieser dritten Ausführungsform der gentechnisch veränderten Zelle bevorzugt, dass es sich bei der Zelle um einen Mikroorganismus handelt, ausgewählt aus der Gruppe der Archaeen .
Bevorzugt handelt es sich bei dem Archaeon um einen ausgewählt aus der Gruppe umfassernd: Methanocaldococcus janaschii Methanothermobacter thermoautotrophicum Ärchaeoglobus fulgidus , Pyrococcus furiosus Mathanosarcina mazei Sulfolobus solfataricus Aeropyrum pernix
Ersetzen der IPP Synthese durch „MVA" gegen IPP Synthese durch „MVA alternativ"
Gemäß einer vierten Ausführungsform der erfindungsgemäßen
Zelle ist diese dadurch gekennzeichnet, dass mindestens eines der im Wildtyp vorhandenen Enzyme ausgewählt ist aus der Gruppe umfassend:
Ein Enzym Eio, welches die Umsetzung von Mevalonat-5-
Phosphat zu Mevalonat-5-Diphosphat katalysiert und ein Enzym En, welches die Umsetzung von Mevalonat-5-
Diphosphat zu Isopentenyldiphosphat katalysiert, und die im Wildtyp nicht vorhandene Enzymaktivität hervorgerufen wird durch mindestens ein Enzym ausgewählt aus der Gruppe umfassend:
Ein Enzym E12, welches die Umsetzung von Mevalonat-5-
Phosphat zu Isopentenylmonophosphat katalysiert und ein Enzym E13, welches die Umsetzung von
Isopentenylmonophosphat zu Isopentenyldiphosphat katalysiert .
Dabei ist es bevorzugt, dass für mindestens eines der
Enzyme E12 oder E13 zutrifft, besonders bevorzugt, dass für jedes Enzym E12 und E13 zutrifft, dass
E12 eine Monophosphomevalonat-Decarboxylase,
E13 eine Isopentenylphosphat-Kinase ist .
In dieser vierten Ausführungsform erfindungsgemäßer Zelle ist besonders bevorzugt mindestens eines, bevorzugt beide der Enzyme:
E12 eine Monophosphomevalonat-Decarboxylase, die sich aus
Methanocaldococcus janaschii isolieren läßt,
E13 Genprodukt ausgewählt aus der Gruppe:
MJ0044 aus Methanocaldococcus janaschii,
MTH47 aus Methanothermobacter thermoautotrophicum,
AF2288 aus Ärchaeoglobus fulgidus,
PF1636 aus Pyrococcus furiosus,
MM1763 aus Mathanosarcina mazei,
SSO0064 aus Sulfolobus solfataricus und
APEl 768 aus Aeropyrum pernix, wobei MJ0044 aus Methanocaldococcus janaschii ganz besonders bevorzugt ist Weiterhin ist es im Zusammenhang mit dieser vierten Ausführungsform der gentechnisch veränderten Zelle bevorzugt, dass es sich bei der Zelle um einen Mikroorganismus handelt wie für die oben genannte, zweite Ausführungsform der gentechnisch veränderten Zelle beschrieben, einschließlich der dargelegten Bevorzugungen
Für alle vier oben genannten Ausführungsformen erfindungsgemäßer Zelle kann es des Weiteren von Vorteil sein, wenn die Zelle mindestens eine im Vergleich zu ihrem Wildtyp geänderte, bevorzugt eine erhöhte Aktivität eines Enzymes Ei4, welches die Umsetzung von Isopentenyldiphosphat zu Dimethylallyldiphosphat katalysiert, aufweist.
Es ist bevorzugt, dass Ei4 Isopentenyldiphosphat-delta- Isomerase (EC:5.3.3.2) ist.
Besonders bevorzugt ist Ei4, Genprodukt eines Isopentenyldiphosphat-delta-Isomerase-Genes, welches sich isolieren lässt aus einer Zelle ausgeählt aus der Gruppe umfassend:
Adonis aestivalis var. palaestina
Adonis aestivalis var. palaestina
Adonis aestivalis var. palaestina
Adonis aestivalis var. palaestina
Aeropyrum pernix
Agrobacterium rhizogenes
Agromyces mediolanus
Anabaena sp . (strain PCC 7120)
Anabaena variabilis (strain ATCC 29413 / PCC 7937)
Anabaena variabilis (strain ATCC 29413 / PCC 7937) Anaeromyxobacter sp . (strain FwlO9-5)
Arabidopsis thaliana
Arabidopsis thaliana
Arabidopsis thaliana
Arabidopsis thaliana
Archaeoglobus fulgidus
Arthrobacter aurescens (strain TCl)
Aspergillus fumigatus
Aspergillus niger
Azoarcus sp . (strain EbNl)
Azoarcus sp. (strain EbNl)
Azotobacter vinelandii AvOP
Bacillus amyloliquefaciens FZB42
Bacillus anthracis
Bacillus cereus (strain ATCC 10987)
Bacillus cereus (strain ATCC 14579 / DSM 31)
Bacillus cereus (strain ZK / E33L)
Bacillus cereus G9241
Bacillus cereus subsp. cytotoxis NVH 391-98
Bacillus coagulans 36Dl
Bacillus liehen!formis (strain DSM 13 / ATCC 14580)
Bacillus sp . NRRL B-14911
Bacillus sp . SG-I
Bacillus subtilis
Bacillus subtilis
Bacillus subtilis
Bacillus thuringiensis serovar israelensis ATCC 35646
Bacillus thuringiensis subsp. konkukian
Bdellovibrio bacteriovorus
Bombyx mori
Borrelia burgdorferi
Borrelia garinii Bos ta urus
Brassi ca oleracea var . botrytis
Brevibacteri um linens
Burkholderia mul ti vorans ATCC 1 761 6
Caldi virga maquilingensis IC-1 67
Caldi virga maquilingensis IC-1 67
Camptotheca acuminata
Camptotheca acuminata
Camptotheca acuminata
Candidatus Nitrosopumilus maritimus SCMl
Capsicum annuum
Catharanthus roseus
Cenarchaeum symbiosum
Chlamydomonas reinhardtii
Chlorobium chlorochromatii (strain CaD3)
Chlorobium ferrooxidans DSM 13031
Chlorobium limicola DSM 245
Chlorobium phaeobacteroides (strain DSM 266)
Chlorobium phaeobacteroides BSl
Chlorobium tepidum
Chloroflexus aggregans DSM 9485
Cinchona robusta
Citrobacter freundii
Citrus sp.
Clarkia breweri
Clarkia breweri
Clarkia xantiana
Clavibacter michiganensis subsp. michiganensis (strain
NCPPB 382)
Clavi ceps purpurea
Clavi ceps sp .
Clostridium beijerinckii NCIMB 8052 Corynebacterium diphtheriae
Corynebacterium efficiens
Corynebacterium glutamicum
Crocosphaera watsonii
Cucurbita sp .
Cyanothece sp. CCY 0110
Cytophaga hutchinsonii (strain ATCC 33406 / NCIMB 9469)
Deinococcus geothermalis (strain DSM 11300)
Deinococcus radiodurans
Desulfotomaculum reducens MI-I
Dichelobacter nodosus (strain VCS1703A)
Dinoroseobacter shibae DFL 12
Enterobacter sp. 638
Enterococcus faecalis
Enterococcus faecium DO
Erwinia carotovora subsp. atroseptica
Escherichia coli
Escherichia coli (strain K12)
Escherichia coli (strain UTI89 / UPEC)
Escherichia coli B
Escherichia coli E24377A
Escherichia coli HS
Escherichia coli 0157 :H7
Escherichia coli 06
Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Escherichia vulneris
Flavobacteria bacterium BBFL 7
Flavobacterium j ohnsoniae UWlOl
Flavobacterium psychrophilum (strain JIP02/86 / ATCC 49511)
Frankia alni (strain ACN14a)
Frankia sp. (strain CcI3)
Frankia sp. EANlpec Gallus gallus gamma proteobacterium HTCC2207
Gramella forsetii (straln KT0803)
Guillardia theta
Haematococcus pluvialis
Haematococcus pluvialis
Haematococcus pluvialis
Haloarcula marlsmortul
Halobacterlum sallnarlum
Halobacterlum sallnarlum
Haloquadratum walsbyl (straln DSM 16790)
Haloquadratum walsbyl (straln DSM 16790)
Halorhodosplra halophlla (straln DSM 244 / SLl)
Halorubrum lacusprofundl ATCC 49239
Halorubrum lacusprofundl ATCC 49239
Herpetoslphon aurantlacus ATCC 23779
Hevea braslllensls
Homo sapiens
Homo sapiens
Homo sapiens
Hyperthermus butyllcus (straln DSM 5456 / JCM 9403)
Hyphomlcroblum zavarzlnll
Ignlcoccus hospltalls KIN4/I
Janlbacter sp. HTCC2649
Klneococcus radlotolerans SRS30216
Kltasatospora grlseola
Lactobaclllus delbrueckll subsp. bulgarlcus (straln ATCC
11842 / DSM 20081)
Lactobaclllus plantarum
Lactobaclllus reuterl 100-23
Lactobaclllus reuterl F275
Lactobaclllus sakel subsp. sakel (straln 23K) Lactobacillus salivarius subsp. salivarius (strain UCC118)
Lactococcus lactis subsp. cremoris (strain MG1363)
Lactococcus lactis subsp. lactis
Lactuca sativa
Lactuca sativa
Legionella pneumophila subsp. pneumophila (strain
Philadelphia 1 / ATCC 33152 / DSM 7513)
Leifsonia xyli subsp. xyli
Leishmania braziliensis
Leishmania infantum
Leishmania major strain Friedlin
Listeria innocua
Listeria monocytogenes
Listeria monocytogenes serotype 4b (strain F2365)
Listeria monocytogenes str . l/2a F6854
Listeria monocytogenes str. 4b H7858
Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM
20650 / SLCC5334)
Lycopersicon esculentum
Lyngbya sp. PCC 8106
Macaca fascicularis marine actinobacterium PHSC20C1
Mesocricetus auratus
Mesocricetus auratus
Metallosphaera sedula DSM 5348
Methanobacterium thermoautotrophicum
Methanobrevibacter smithii (strain PS / ATCC 35061 / DSM
861)
Methanococcoides burtonii (strain DSM 6242)
Methanococcus aeolicus (strain Nankai-3 / ATCC BAA-1280)
Methanococcus jannaschii
Methanococcus maripaludis Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
Methanococcus maripaludis (strain Cl / ATCC BAA-1331)
Methanococcus vannielii SB (strain SB / ATCC 35089 / DSM
1224)
Methanocorpusculum labreanum (strain ATCC 43576 / DSM 4855
/ Z)
Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 /
JRl)
Methanopyrus kandier!
Methanoregula boonei (strain 6A8)
Methanosaeta thermophila (strain DSM 6194 / PT)
Methanosarcina acetivorans
Methanosarcina barkeri (strain Fusaro / DSM 804)
Methanosarcina mazei
Methanosphaera stadtmanae (strain DSM 3091)
Methanospirillum hungatei (strain JF-I / DSM 864)
Methanothermobacter thermautotrophicus
Microscilla marina ATCC 23134
Microscilla marina ATCC 23134
Moorella thermoacetica (strain ATCC 39073)
Morinda citrifolia
Mus musculus
Mus musculus
Mycobacterium avium (strain 104)
Mycobacterium bovis
Mycobacterium bovis (strain BCG / Paris 1173P2)
Mycobacteri um gil vum PYR-GCK
Mycobacteri um gil vum PYR-GCK
Mycobacterium smegmatis (strain ATCC 700084 / mc(2)155)
Mycobacterium sp. (strain JLS)
Mycobacterium sp . (strain KMS)
Mycobacterium sp. (strain MCS) Mycobacterium tuberculosis
Mycobacterium vanbaalenii (strain DSM 7251 / PYR-I)
Mycobacterium vanbaalenii (strain DSM 7251 / PYR-I)
Mycoplasma laidlawii
Myxococcus xanthus (strain DK 1622)
Narcissus pseudonarcissus
Natronomonas pharaonis (strain DSM 2160 / ATCC 35678)
Natronomonas pharaonis (strain DSM 2160 / ATCC 35678)
Natronomonas pharaonis (strain DSM 2160 / ATCC 35678)
Natronorubrum sp . Tenzan-10
Nicotiana benthamiana
Nicotiana langsdorffii x Nicotiana sanderae
Nicotiana tabacum
Nocardia farcinica
Nocardia farcinica
Nodularia spumigena CCY 9414
Nodularia spumigena CCY 9414
Oceanobacillus iheyensis
Oryza sativa
Paracoccus zeaxanthinifaciens
Parvularcula bermudensis HTCC2503
Pelodictyon luteolum (strain DSM 273)
Pelodictyon phaeoclathratiforme BU-I
Phaffia rhodozyma
Phaffia rhodozyma
Photobacterium profundum
Photorhabdus luminescens subsp. laumondii
Photorhabdus luminescens subsp. laumondii
Pichia stipitis
Picrophilus torridus
Pinus radiata
Pongo pygmaeus Propionibacterium acnes
Prosthecochloris aestuarii DSM 271
Prosthecochloris vibrioformis DSM 265
Pseudomonas entomophila (strain L48)
Pyrobaculum aerophilum
Pyrobaculum arsenaticum (strain DSM 13514 / JCM 11321)
Pyrobaculum calidifontis (strain JCM 11548 / VAl)
Pyrobaculum islandicum (strain DSM 4184 / JCM 9189)
Pyrococcus abyssi
Pyrococcus furiosus
Pyrococcus horikoshii
Pyrococcus kodakaraensis
Rattus norvegicus
Rattus norvegicus
Rhizobium etli (strain CFN 42 / ATCC 51251)
Rhizobium loti
Rhodobacter capsulatus
Rhodobacter sphaeroides (strain ATCC 17023 / 2.4.1 / NCIB
8253 / DSM 158)
Rhodobacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Rhodobacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Rhodococcus sp . (strain RHAl)
Ricinus communis
Rickettsia bellii (strain RML369-C)
Rickettsia conorii
Rickettsia felis
Rickettsia prowazekii
Rickettsia typhi
Roseiflexus castenholzii DSM 13941
Roseiflexus sp. (strain RS-I)
Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129) Saccharomyces cerevisiae
Saccharomyces cerevisiae
Saccharopolyspora erythraea (strain NRRL 23338)
Saccharopolyspora erythraea (strain NRRL 23338)
Salinibacter ruber (strain DSM 13855)
Salinispora arenicola CNS205
Salinispora arenicola CNS205
Salinispora tropica CNB-440
Salmonella choleraesuis
Salmonella paratyphi-a
Salmonella typhi
Salmonella typhimurium
Salvia officinalis
Schizosaccharomyces pombe
Schizosaccharomyces pombe
Serratia proteamaculans 568
Shigella boydii serotype 4 (strain Sb227)
Shigella dysenteriae serotype 1 (strain Sdl97)
Shigella flexneri
Shigella sonnei (strain SsO46)
Silicibacter pomeroyi
Staphylococcus aureus
Staphylococcus aureus (strain bovine RF122)
Staphylococcus aureus (strain COL)
Staphylococcus aureus (strain MRSA252)
Staphylococcus aureus (strain MSSA476)
Staphylococcus aureus (strain Mu50 / ATCC 700699)
Staphylococcus aureus (strain MW2)
Staphylococcus aureus (strain N315)
Staphylococcus aureus (strain USA300)
Staphylococcus epidermidis (strain ATCC 12228)
Staphylococcus epidermidis (strain ATCC 35984 / RP62A) Staphylococcus haemolyticus (strain JCSC1435)
Staphylococcus saprophyticus subsp. saprophyticus (strain
ATCC 15305 / DSM 20229)
Staphylothermus marinus (strain ATCC 43588 / DSM 3639 / Fl)
Stevia rebaudiana
Stigma tella a uran tiaca DW4/3-1
Streptococcus agalactiae 18RS21
Streptococcus agalactiae serotype Ia
Streptococcus gordonii str . Challis substr . CHI
Streptococcus mutans
Streptococcus pneumoniae
Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Streptococcus pneumoniae serotype 2 (strain D39 / NCTC
7466)
Streptococcus pneumoniae SP11-BS70
Streptococcus pneumoniae SP14-BS69
Streptococcus pneumoniae SP18-BS74
Streptococcus pneumoniae SP19-BS75
Streptococcus pneumoniae SP23-BS72
Streptococcus pneumoniae SP3-BS71
Streptococcus pneumoniae SP6-BS73
Streptococcus pneumoniae SP6-BS73
Streptococcus pneumoniae SP9-BS68
Streptococcus pyogenes serotype Ml
Streptococcus pyogenes serotype M12 (strain MGAS2096)
Streptococcus pyogenes serotype M12 (strain MGAS9429)
Streptococcus pyogenes serotype M18
Streptococcus pyogenes serotype M2 (strain MGAS10270)
Streptococcus pyogenes serotype M28
Streptococcus pyogenes serotype M3
Streptococcus pyogenes serotype M4 (strain MGAS10750)
Streptococcus pyogenes serotype M5 (strain Manfredo) Streptococcus pyogenes serotype M6
Streptococcus sanguinis (strain SK36)
Streptococcus suis 89/1591
Streptomyces avermitilis
Streptomyces coelicolor
Streptomyces sp. (strain CLl 90)
Sulfolobus acidocaldarius
Sulfolobus shibatae
Sulfolobus shibatae
Sulfolobus shibatae
Sulfolobus solfatarlcus
Sulfolobus tokodall
Sus scrofa
Symblobacterlum thermophllum
Synechococcus elongatus
Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG
1402/1)
Synechococcus sp. (strain JA-2-3B 'a (2-13) )
Synechococcus sp. (strain JA-3-3Ab)
Synechococcus sp. (strain PCC 7942)
Synechocystls sp.
Synechocystls sp. (strain PCC 6803)
Syntrophomonas wolfel subsp. wolfel (strain Goettlngen)
Tagetes erecta
Thermococcus kodakaraensls
Thermofllum pendens (strain Hrk 5)
Thermoplasma acldophllum
Thermoplasma volcanlum
Thermoslnus carboxydlvorans Norl
Thermus thermophllus
Thermus thermophll us (s train HB27 / ATCC BAA-1 63 / DSM
7039) Thermus thermophilus (strain HB27 / ATCC BAA-I 63 / DSM
7039)
Thiomicrospira crunogena (strain XCL-2)
Trichodesmium erythraeum (strain IMSlOl)
Trypanosoma brucei
Trypanosoma cruzi
Uncultured methanogenic archaeon RC-I
Vibrio fischeri (strain ATCC 700601 / ES114)
Vibrio harveyi HYOl
Vibrio parahaemolyticus
Vibrio parahaemolyticus AQ3810
Vibrio sp . Ex25
Xanthobacter sp. (strain Py2)
Zea mays
Weitere Gene zur Expression
Es ist dem Fachmann geläufig, dass ein addiction-Sytem generell dazu genutzt werde kann, um ein oder mehrere weitere Fremdgene stabil in einer Zelle zu erhalten, und somit die Genprodukte der Fremdgene produziert werden können, so wie es beispielsweise in einem Expressionssystem geschieht .
Gegenstand der Erfindung ist somit ebenfalls eine vorstehend beschriebene gentechnisch veränderte Zelle, die mindestens ein zusätzliches Fremdgen expremiert.
Die Genprodukte der Fremdgene können wiederum von der erfindungsgemäßen Zelle genutzt werden, weitere Substanzen zu erzeugen.
Beipiele für zusätzliches Fremdgene sind: Mitglieder des
PHA-Synthese Gen Clusters (z. B. phaC, phaA, phaß-Cluster aus z. B. R. eutropha, P. oleovorans, P. aeruginosa, Thiocapsa pfennigii) , Synthesegene für Polythioester und abgeleitete Sequenzen zur Erzeugung eines „künstlichen Stoffwechselweges" zur mikrobiellen Polythioestersynthese
(z. B. eine Butyratkinase [Buk; EC 2.7.2.7] aus Clostridium acetobutylicum, eine Phosphotransbutyrylase [Ptb; EC 2.3.1.19] aus Clostridium acetobutylicum, und PHA-Synthase Gene (phaE und phaC) aus z. B. Chromatium vinosum oder Thiocapsa pfennigii und abgeleitete Sequenzen, vgl. Lütke- Eversloh et al . [2000] in Nature Materials: Biosynthesis of novel thermoplastic polythioesters by engineered Escherichia coli, sowie Liu und Steinbüchel 2000 in Applied and Environmental Microbiology : A Novel Genetically Engineered Pathway for Synthesis of PoIy (Hydroxyalkanoic Acids) in Escherichia coli.), Mitglieder des Alginat- Synthese-Gen-Clusters und abgeleitete Sequenzen (z. B. das Alginat Biosynthese Gen algX aus z. B.Pseudomonas aeruginosa PAOl. und Enzyme gelsistet in; A. Becker et al .
[1998] : Xanthan gum biosynthesis and application: a biochemical /genetic perspective) , Xanthan-Biosynthese-Gene und abgeleitete Sequenzen sowie Gene für die Produktion weiterer Polysaccharide (z. B. Glycosyltransferase-Gene) , Cyanophycin-Synthese Gene und abgeleitete Sequenzen (z. B. cphÄ; cphÄl; cphA2 aus z. B. Synechocystis PCC6208, Anabaena variabilis sp . ATCC 29413 Cyanothece sp . ATCC 51142; Cyanobakterien; Acinetobacter calcoaceticus; Gene kodierend für Insulin (z. B. ins aus z. B. homo sapiens; Wachsestersynthasen und abgeleitete Sequenzen (z. B. Wachs estersynthase/Acyl-CoA: diacylglycerol Acyltransferase ws/dgat aus z. B. Acinetobacter calcoaceticus ADPl oder Mycobacterium smegmatis vgl. R. Kaischeuer und Steinbüchel, 2003 in J Biol Chem.), Gene zur sowohl template-basierten als auch template-unabhängigen Synthese für Polyaminosäuren und abgeleitete Sequenzen, Gene zur Polylactat-Synthese und abgeleitete Sequenzen, Gene zur Methylcitronensäure Synthese und abgeleitete Sequenzen (z. B. prpC aus z. B. P. putida KT2440, R. eutropha H16 oder Aspergillus niger und in WO2007101866 gelistete) .
Verfahren zur Herstellung der Zellen
Einen weiteren Beitrag zur Lösung der eingangs genannten Aufgaben leistet ein Verfahren zur Herstellung einer gentechnisch veränderten Zelle, umfassend die Verfahrensschritte A) Erniedrigung der Aktivität mindestens eines der bereits im Wildtyp vorhandenen Enzyme Ei bis E6 und B) Steigerung mindestens einer bevorzugt mindestens zwei, weiter bevorzugt mindestens drei, darüber hinaus weiter bevorzugt mindestens vier und am meisten bevorzugt mindestens fünf der nicht im Wildtyp vorhandenen Enzymaktivitäten von E7 bis En.
Die Steigerung der Enzymaktivitäten wird durch Einbringen mindestens einer exogenen Nukleinsäure in die Zelle erreicht; diese exogene Nukleinsäure vermag ohne Selektionsdruck stabil in der gentechnisch veränderten Zelle zu verweilen und wird weiterhin in die nächste Generation übertragen.
In diesem Zusammenhang ist es bevorzugt, dass diese exogene Nukleinsäure in das Genom der Zelle integriert wird oder aber in Form eines Expressionsvektors in die Zelle eingeführt wird.
In dieser Ausführungsform des erfindungsgemäßen Verfahrens zur Herstellung einer gentechnisch veränderten Zelle ist bevorzugt : E6 Genprodukt des ispH
E7 Genprodukt des mvaS aus Staphylococcus aureus ,
E8 Genprodukt des mvaÄ aus Lactobacillus lactis und aus
Staphylococcus aureus,
E9 Genprodukt des mvaKl aus Staphylococcus aureus,
Eio Genprodukt des mvaK2 aus Staphylococcus aureus und
En Genprodukt des mvaD aus Staphylococcus aureus.
Weiterhin ist es im Zusammenhang mit der vorstehend beschriebenen Ausführungsform des erfindungsgemäßen
Verfahrens bevorzugt, dass es sich bei der Zelle um einen nur über den MEP-Weg zur IPP-Synthese befähigten
Mikroorganismus, bevorzugt ausgewählt aus der Gruppe umfassend:
Eubakterien,
Piastiden von Apicomplexa und Piastiden höherer Pflanzen handelt .
Unter den Eubakterien sind insbesondere diejenigen Zellen bevorzugt, ausgewählt aus der Gruppe umfassend: Lactobacillus , Lactococcus , Escherichia, Staphylococcus , Ralstonia , Bacillus , Corynebacterium, Xanthomonas , Pseudomonas , Streptococcus , Peptostreptococcus , Leuconostoc, Alcanivorax, Agrobacterium, Bifidobacterium, Borellia , Burkholderia, Clostridium, Enterococcus , Fusobacterium, Gluconobacter, Gordonia , Helicobacter, Micrococcus , Mycobacterium, Nocardia,
Porphyromonas , Propionibacterium, Rhizobium, Rhodococcus , Salmonella, Zymomonas , Vibrio, Myxococcus , Chromobacterium, Nitrosomonas , Citrobacter, Paracoccus , Thiobacillus , Desulfovibrio, Streptomyces , Acinetobacter, Comamonas , Escherichia coli, Lactococcuss lactis , Lactobacillus brevis , S aureus Ralstonia eutropha , Ralstonia solanacearum, Ralstonia metallidurans , Bacillus subtilis , Bacillus cereus , Bacillus megaterium, Bacillus anthracis , Bacillus licheniformes , Bacillus thuringiensis , Corynebacterium glutamicum, Xanthomonas campestris , Pseudomonas putida, Pseudomonas oleovorans , Pseudomonas aeruginosa, Pseudomonas fluoreszens , Streptococcus salivarius , Staphylococcus aureus, Staphylococcus epidermidis , Peptostreptococcus sp . , Leuconostoc mesenteroides (subsp. dextranicum) , Azotobacter vinelandii, Azotobacter chroococcum, Alcanivorax borkumensis , Agrobacterium tumefaciens , Bifidobacterium longum, Borellia burgdorferi, Burkholderia pseudomallei , Clostridium acetobutylicum, Clostridium propionicum, Clostridium pasteurianum, Enterococcus faecalis , Fusobacterium nucleatum, Gluconobacter oxydans , Gordonia westfalica, Gordonia polyisoprenivorans , Helicobacter pylori, Micrococcus luteus , Mycobacterium smegmatis , Mycobacterium bovis , Mycobacterium leprae, Mycobacterium tubercolosis , Nocardia farcinica, Porphyromonas gingivalis , Propionibacterium freudenreichii , Rhizobium leguminosarum, Rhodococcus opacus , Salmonella enterica , Salmonella typhimurium, Zymomonas mobilis , Vibrio fisheri , Vibrio cholerae, Myxococcus sp., Chromobacterium violaceum, Nitrosomonas europaea, Nitrobacter winogradskyi , Paracoccus denitrificans Thiobacillus ferrooxidans , Desulfovibrio desulfuricans , Streptomyces coelicolor, Streptomyces albulus , Acinetobacter borkumensis und Comamonas testosteroni . Ebenso bevorzugte Vertreter von Eubakterien sind ausgewählt aus der Gruppe umfassend alle einen obligat oder fakultativ phototrophen Stoffwechsel besitzenden Proteobakterien, besonders bevorzugt sind hier Rhodospirillum, Rhodobacter, Allochromatium, Chromatium, Synechococcus , Rhodospirillum rubrum, Rhodobacter sphaeroides , Allochromatium vinosum, Chromatium okenii, Synechococcus sp .
Unter den Apicomplexa sind insbesondere diejenigen Zellen bevorzugt, ausgewählt aus der Gruppe umfassend:
Plasmodium,
Paramecium,
Tetrahymena,
Chlamydomonas reinhardtii
Theileria annulata,
Theileria parva
Verfahren zur Herstellung delta mvaKl : : ispC-H Einen weiteren Beitrag zur Lösung der eingangs genannten Aufgaben leistet ein Verfahren zur Herstellung einer gentechnisch veränderten Zelle, umfassend die Verfahrensschritte A) Erniedrigung der Aktivität mindestens eines der bereits im Wildtyp vorhandenen Enzyme E7 bis En und B) Steigerung mindestens einer bevorzugt mindestens zwei, weiter bevorzugt mindestens drei, darüber hinaus weiter bevorzugt mindestens vier, darüber hinaus weiter bevorzugt mindestens fünf und am meisten bevorzugt mindestens sechs der nicht im Wildtyp vorhandenen Enzymaktivitäten von Ei bis E6.
Die Steigerung der Enzymaktivitäten wird durch Einbringen mindestens einer exogenen Nukleinsäure in die Zelle erreicht; diese exogene Nukleinsäure vermag ohne Selektionsdruck stabil in der gentechnisch veränderten
Zelle zu verweilen und wird weiterhin in die nächste
Generation übertragen.
In diesem Zusammenhang ist es bevorzugt, dass diese exogene
Nukleinsäure in das Genom der Zelle integriert wird oder aber in Form eines Expressionsvektors in die Zelle eingeführt wird.
In dieser Ausführungsform des erfindungsgemäßen Verfahrens zur Herstellung einer gentechnisch veränderten Zelle ist bevorzugt :
Eio Genprodukt des mvaKl,
Ei Genprodukt des ispC,
E2 Genprodukt des ispD,
E3 Genprodukt des ispE,
E4 Genprodukt des ispF,
E5 Genprodukt des ispG und
E6 Genprodukt des ispH.
Weiterhin ist es im Zusammenhang mit dem vorstehend beschriebenen Ausführungsform des erfindungsgemäßen
Verfahrens bevorzugt, dass es sich bei der Zelle um einen nur über den MVA-Weg zur IPP-Synthese befähigten
Mikroorganismus, bevorzugt ausgewählt aus der Gruppe umfassend:
Hefen,
Pilze, handelt .
Unter den Pilzen sind insbesondere diejenigen Zellen bevorzugt, ausgewählt aus der Gruppe umfassend: Absidia Agaricus Ajellomyces
Arthroderma
Acremonium
Aspergillus
Disporotrichum
Geosmithia
Mortierella
Paecilomyces
Penicillium
Rhizopus
Trichoderma
Talaromyces
Thielavia .
Unter den Hefen sind insbesondere diejenigen Zellen bevorzugt, ausgewählt aus der Gruppe umfassend:
Candida
Pichia
Sacharomyces
Arxula
Klyveromyces
Yarrowia
Hansenula
Brettanomyces
Zellen, die durch Verfahren hergestellt wurden Einen weiteren Beitrag zur Lösung der eingangs genannten Aufgaben leistet weiterhin die durch die vorstehend beschriebenen Verfahren erhältlichen, gentechnisch veränderten Zellen. Relevantes Plasmid
Einen Beitrag zur Lösung der eingangs genannten Aufgabe leistet weiterhin eine isolierte Nukleinsäure pCOLADuet- 1: :MVAl-5 mit der Sequenz nach SEQ ID NO: 3.
Verfahren zu Herstellung von Produkten mit erfindungsgemäßen Zellen
Wie eingangs beschrieben werden addiction-Systeme in biotechnologischen Produktionsprozessen eingesetzt; die gentechnische Manipulation der das addiction-System aufweisenden Zelle ist daher in diesem Zusammenhang zwangsläufig mit der Herstellung von gewünschten Produkten verbunden. In Zusammenhang mit der vorliegenden Erfindung ist als Produkt jede Substanz zu verstehen, die von erfindungsgemäßer Zelle aufgrund der gentechnischen Veränderung im Vergleich zu ihrem Wildtyp vermehrt synthetisiert wird. Dies können daher beispielsweise Zwischenprodukte der IPP-Stoffwechselwege, Genprodukte der Fremdgene, aber auch durch die Genprodukte der Fremdgene synthetisierten Substanzen sein, wie z. B. das unten beschriebene Cyanophycin.
Erfindungsgemäßes Verfahren zur Herstellung von Produkten umfasst den Verfahrensschritt des in Kontakt Bringens einer erfindungsgemäßen Zelle mit einem Nährmedium beinhaltend eine Kohlenstoffquelle unter Bedingungen, unter denen Produkt gebildet wird, sowie gegebenenfalls Aufreinigung des Produktes aus der Kultur.
Die erfindungsgemäßen, gentechnisch veränderten Zellen können kontinuierlich oder diskontinuierlich im batch- Verfahren (Satzkultivierung) oder im fed-batch-Verfahren (Zulaufverfahren) oder repeated-fed-batch-Verfahren (repetitives Zulaufverfahren) zum Zwecke der Produktion mit dem Nährmedium in Kontakt und somit kultiviert werden. Denkbar ist auch ein semi-kontinuierliches Verfahren, wie es in der GB-A-1009370 beschrieben wird. Eine Zusammenfassung über bekannte Kultivierungsmethoden sind im Lehrbuch von Chmiel („Bioprozesstechnik 1. Einführung in die Bioverfahrenstechnik" (Gustav Fischer Verlag, Stuttgart, 1991)) oder im Lehrbuch von Storhas („Bioreaktoren und periphere Einrichtungen", Vieweg Verlag, Braunschweig/Wiesbaden, 1994) beschrieben.
Das zu verwendende Kulturmedium muss in geeigneter Weise den Ansprüchen der jeweiligen Stämme genügen. Beschreibungen von Kulturmedien verschiedener Mikroorganismen sind im Handbuch "Manual of Methods for General Bacteriology" der American Society for Bacteriology (Washington D. C, USA, 1981) enthalten. Als Kohlenstoffquelle können Kohlehydrate wie z. B. Glucose, Saccharose, Lactose, Fructose, Maltose, Melasse, Stärke und Cellulose, Öle und Fette wie z. B. Sojaöl, Sonnenblumenöl, Erdnussöl und Kokosfett, Fettsäuren wie z. B. Palmitinsäure, Stearinsäure und Linolsäure, Alkohole wie z. B. Glycerin und Methanol, Kohlenwasserstoffe wie Methan, Aminosäuren wie L-Glutamat oder L-Valin oder organische Säuren wie z. B. Essigsäure sowie Kohlendioxid bei chemolitho-autotroph wachsenden Mikroorganismen zum Beispiel Ralstonia eutropha bzw. photo-autotroph wachsenden Mikroorganismen wie zum Beispiel Rhodobacter sphaeroides , verwendet werden. Diese Stoffe können einzeln oder als Mischung verwendet werden. Weiter bevorzugt ist der Einsatz von Komplexmediumbestandteilen aus Resten von Agrargütererzeugnissen . Besonders bevorzugt ist der Einsatz von Kohlehydraten, insbesondere Monosaccharide, Oligosaccharide oder Polysaccharide, wie dies in US 6,01,494 und US 6,136,576 beschrieben ist, von C5-Zuckern oder von Glycerin.
Als Stickstoffquelle können organische Stickstoffhaltige Verbindungen wie Peptone, Hefeextrakt, Fleischextrakt, Malzextrakt, Maisquellwasser, Sojabohnenmehl und Harnstoff oder anorganische Verbindungen wie Ammoniumsulfat, Ammoniumchlorid, Ammoniumphosphat, Ammoniumcarbonat und Ammoniumnitrat bzw. N2 bei Stickstofffixierenden Mikroorganismen z. B. Rhizobium leguminosarum oder auch Cyanobakterien verwendet werden. Die Stickstoffquellen können einzeln oder als Mischung verwendet werden.
Als Phosphorquelle können Phosphorsäure,
Kaliumdihydrogenphosphat oder Dikaliumhydrogenphosphat oder die entsprechenden Natrium-haltigen Salze verwendet werden. Das Kulturmedium muss weiterhin Salze von Metallen enthalten wie z. B. Magnesiumsulfat oder Eisensulfat, die für das Wachstum notwendig sind. Schließlich können essentielle Wuchsstoffe wie Aminosäuren und Vitamine zusätzlich zu den oben genannten Stoffen eingesetzt werden. Dem Kulturmedium können überdies geeignete Vorstufen zugesetzt werden. Die genannten Einsatzstoffe können zur Kultur in Form eines einmaligen Ansatzes hinzugegeben oder in geeigneter Weise während der Kultivierung zugefüttert werden .
Zur pH-Kontrolle der Kultur werden basische Verbindungen wie Natriumhydroxid, Kaliumhydroxid, Ammoniak bzw. Ammoniakwasser oder saure Verbindungen wie Phosphorsäure oder Schwefelsäure bzw. Kohlensäure in geeigneter Weise eingesetzt. Zur Kontrolle der Schaumentwicklung können Antischaummittel wie z. B. Fettsäurepolyglykolester oder Pflanzenöl eingesetzt werden. Weitere geläufige Methoden der Prozesskontrolle und Schaumkontrollsysteme für Fermentationsprozesse können in einschlägiger Literatur nachgelesen werden. Zur Aufrechterhaltung der Stabilität von (weiteren) Plasmiden können dem Medium geeignete selektiv wirkende Stoffe wie z. B. Antibiotika hinzugefügt werden. Um aerobe Bedingungen aufrechtzuerhalten, werden Sauerstoff oder Sauerstoff-haltige Gasmischungen, wie z. B. Luft, in die Kultur eingetragen. Die Temperatur der Kultur liegt normalerweise bei 20 0C bis 45 0C und vorzugsweise bei 25 0C bis 40 0C. Insbesondere bei der Verwendung von Zellen, welche Glycerin als Substrat umwandeln können, kann es bevorzugt sein, als Zellen solche Zellen einzusetzen, die in der US 6,803,218 beschrieben werden. In diesem Fall können die Zellen bei Temperaturen im Bereich von 40 bis 100 0C kultiviert werden.
Die Zellen können, falls das Produkt nicht in das Kulturmedium sezerniert wird, aufgeschlossen, und das Produkt nach bekannten Aufreinigungsverfahren aus dem Lysat gewonnen werden. Die Zellen können beispielsweise durch hochfrequenten Ultraschall, durch hohen Druck, wie z. B. in einer French-Druckzelle, durch Osmolyse, durch Einwirkung von Detergenzien, lytischen Enzymen oder organischen Lösungsmitteln, durch Homogenisatoren oder durch Kombination mehrerer der aufgeführten Verfahren aufgeschlossen werden.
Die Aufreinigung des Produktes kann mit bekannten, chromatographischen Verfahren erzielt werden, wie beispielsweise Tangentialfiltration, Fällung, Destillation, Molekularsieb-Chromatographie (GeIfiltration) , Q- Sepharose-Chromatographie, Ionenaustauseh-Chromatographie, Affinitätschromatographie, hydrophobe Chromatographie, sowie mit anderen üblichen Verfahren wie Ultrafiltration, Kristallisation, Aussalzen, Dialyse und nativer Gelelektrophorese .
Produkte aus Verfahren mit erfindungsgemäßen Zellen Ebenfalls Bestandteil der Erfindung sind Produkte, hergestellt mit dem vorstehend beschriebenen, erfindungemäßen Verfahren zur Herstellung von Produkten. Bevorzugt ist das Produkt ausgewählt aus der Gruppe umfassend
Isoprenoide und Terpenoide (wie beispielsweise Steroide, Flavonoide, Gummistoffe oder Carotenoide) , Monoterpene, Sesquiterpene, Diterpene, Triterpene, Polyterpene, Cyclische Monoterpene, Cyclische Sesquiterpene, Cyclische Diterpene, Cyclische Triterpene oder auch Hormone, Fette, Öle oder Vitamine und das Genprodukt des Fremdgens.
In den nachfolgend aufgeführten Beispielen wird die vorliegende Erfindung beispielhaft beschrieben, ohne dass die Erfindung, deren Anwendungsbreite sich aus der gesamten Beschreibung und den Ansprüchen ergibt, auf die in den Beispielen genannten Ausführungsformen beschränkt sein soll .
Folgende Figuren sind Bestandteil der Offenbarung: Figur 1: Der MEP-Weg Figur 2 : Der MVA-Weg Figur 3: Kultivierung von E. coli HMS174 (DE3) pColaDuet-
1: :MVAl-5 und E. coli HMS174 (DE3) MspH Ω FRT/Amp/FRT pCOLADuet-1 : :MVAl-5 in LB-Medium.
Figur 4: Plasmidkarte pCOLADuet-1 : :MVAl-5 : : cphA
Figur 5: Fremdgenexpression
Beispiele :
Herstellung des pCOLADuet-1 : :MVAl-5
Für die DNA-Manipulationen wurden Standardtechniken benutzt wie sie in Sambrook, J. et al . (1989), "Molecular Cloning: a laboratory manual", 2nd Ed., CoId Spring Harbor Laboratory Press, CoId Spring Harbor, New York, angegeben sind. Die für Klonierungen genutzten Enzyme stammen von New England Biolabs, Ipswich, MA, und wurden gemäß Herstellerangeben eingesetzt.
Zur Herstellung des pCOLADuet-1 : : MVAl -5, SEQ ID NO: 3, wurden zunächst zwei Plasmide, pCOLADuet-1 : :MVA-top, SEQ ID NO: 1, und pCOLADuet-1 : :MVA-bottom, SEQ ID NO: 2, durch die Firma BioBasic Inc., Ontario, Canada, künstlich synthetisiert .
Beide Plasmide wurden mit Kpnl / Mfel, verdaut; das erhaltene 2103 Basenpaar große Fragment aus pCOLADuet- 1 : :MVA-bottom wurde in das 8321 Basenpaar große Fragment aus pCOLADuet-1 : :MVA-top unter Erhalt von pCOLADuet- 1 : :MVAl-5 ligiert .
Die Sequenz des Vektors wurde durch Sequenzierung bei der Firma GATC Biotech, Konstanz, Schweiz, überprüft. Transformation von pColaDuet-1 : :MVAl-5 in E. coli Die Transformation des pCOLADuet-1 : :MVAl-5 (KmR) Hybridplasmids in E. coli HMS174 (DE3) fand gleichzeitig mit einer Transformation des PLasmides pRed/ET (TcR) (Fa . Genebridges) statt. Die Selektion erfolgte auf entsprechenden LB-Agarplatten mit Kanamycin (50 μg/ml Endkonzentration) und Tetrazyklin (12,5 μg/ml Endkonzentration) als Selektionsmarker für eine positive Selektierung.
Die Kultivierung bei erfolgte bei 300C, da sonst Plasmidverlust und Induktion des Hybridplasmids pRed/ET zu befürchten war. Der so generierte Stamm wird im folgenden als „E. coli HMS174 (DE3) pColaDuet-1 : :MVAl-5" bezeichnet.
Hers tell ung der ispH-Mu tan te von E . coli HMS1 74 (DE3) pColaDuet-1 : :MVAl -5
Die Amplifizierung der FRT/Amp/FRT Selektionskassette
(Fa . Genebridges) zur Erhaltung homologer 5 "und 3" DNA Sequenzen des ispH-Gens wurde mittels AccuPrimePfx Polymerase (Invitrogen) und zweistufiger PCR (Denaturierung bei 95 0C für 15 sec; Elongation 68 0C für 2 Minuten) .
(Primersequenzen : ispH_integr_fw: 5'- atgcagatcctgttggccaacccgcgtggtttttgtgccggggtagaccgaattaaccc tcactaaagggcggc-3 ' ) (ispH_integr_rev: 5S- ttcacgaatatcgacacgcagctctttcggcacttcgaaaacaatgtttttaatacgac tcactatagggctc-3 s ) durchgeführt. Das Fragment (ca. 1,8 kbp) wurde mittels Agarosegel isoliert (Gel Extraktions Kit Fa.Qiagen) . 400 μg wurden für die Red/Et vermittelte Integration mittels Elektroporation nach den Herstellerangaben der Fa. Genebridges nach E. coli HMS174(DE3) pColaDuet-1 : :MVAl-5 transformiert und weiterbehandelt .
Der so generierte Stamm wird im folgenden als „E . coli HMS174 (DE3) AispH ΩFRT/Amp/FRT pColaDuet-1 : :MVAl-5" bezeichnet .
Der Kontrollversuch wurde mit E. coli HMS174 (DE3) ohne pCOLADuet-1 : :MVAl-5 durchgeführt. Eine Selektion der erhaltenen Klone wurde für den Ansatz mit MVA1-5 auf Kanamycin (Km) / Ampicillin (Amp) LB-Platten und für die Kontrolle ohne MVA1-5 auf Amp LB-Platten ausplattiert. Die Kontrolle zeigte keine vitalen Kolonien, welche bei einer nicht letalen Integration der FRT/Amp/FRT Integration in das ispH-Gen entstanden sein müssten. Der Stamm E. coli HMS174 (DE3) AispH ΩFRT/Amp/FRT pColaDuet-1 : :MVAl-5 zeigte ca. 320 Kolonien bildende Einheiten (cfu) bei gleicher ausplattierter Menge an Zellen aus dem Regenerationsansatz. Es folgten zahlreiche Versuche die belegten, dass die Ampicillinresistenz genomisch korrekt integriert wurde und dauerhaft erhalten blieb.
Vektorstabilität ohne Antibiotikum in ispH-Mutante Die stabilisierende Wirkung in E. coli HMS174 (DE3) ΔispH ΩFRT/Amp/FRT pColaDuet-1 : :MVAl-5 gegenüber dem Stamm E. coli HMS174 (DE3) pColaDuet-1 : :MVAl-5 konnte festgestellt werden: E. coli HMS174 (DE3) ΔispH ΩFRT/Amp/FRT pColaDuet-1 : :MVAl-5 wies keinen quantifizierbarer Plasmidverlust auf, E. coli HMS174 (DE3) pColaDuet-1 : :MVAl-5 hingegen wies einen Plasmidverlust über 24h von 20% auf, . Figur 3 zeigt Zellwachstum der rekombinanten Zellen. Das Zellwachstum wurde als Trübungsmessung über ein Klett Summerson Colorimeter (Filter Nr. 54; Manostat Corporation Cat. Nr. 76-550-220, USA) bei 520nm ermittelt. Das Wachstums-Monitoring wurde in relativen Klett-Units (KU) gegen unbeimpftes Medium verfolgt.
Die verwendeten rekombinanten Stämme von E. coli wurden mit 1 % einer 12stündigen Vorkultur (LB-Medium mit entspr. Antibiotika: Rifampizin für E. coli HMS174 (DE3) + Kanamycin für pColaDuet-1 und gegebenenfalls Ampicillin für genomisches Insertionsfragment) angeimpft und in einem 4- fach Schikane Klett-Kolben (250 ml Gesamtvolumen mit 100ml LB-Medium) bei 37 0C und 180 rpm kultiviert. Die Messung der optischen Dichte erfolgte aus dem Schikane-Klett-Kolben direkt mit einem Klett Summerson Colorimeter. Zur Bestimmung des Plasmidverlustes wurden die Zellen mit steriler Saline (NaCl 0,9 % in H2O) einheitlich verdünnt und in gleichen Volumina auf LB und LB-Selektionsplatten (mit 50μg Kanamycin) ausplattiert. Nach einer Inkubation bei 37 0C für 24 h erfolgte die Auszählung der Kolonie¬ bildenden Einheiten (cfu) hinsichtlich der aufgetretenen Kolonie zahlen .
Figure imgf000059_0001
Figure imgf000060_0001
Herstellung eines addiction-System Plasmides mit zusätzlichem Fremdgen: pColaDuet-1 : :MVAl-5 : : cphA Es wurde als beispielhaftes Fremdgene die T7 Cyanophycin- Synthethase (cphA6308C595S) Transkriptionseinheit in das Plasmid pCOLADuet-1 : :MVAl-5 funktional einkloniert Ausgehend von einem gereinigtem template Plasmid, pET23a: :cphA6308C5956S, umfassend eine DNA kodierend für die Cyanophycinsynthetase mit NCBI accession number: AAF43647, enthaltend eine Aminosäure-Modifikation [C595S], wurde mittels des 5 ' Primers „pET23aXhoIT7_fw" (5'- AACTCGAGATTAATACGACTCACTATAGG-3 s ) und des 3 s Primers „T7- Terminator" δ'-GCTAGTTATTGCTCAGCGG-S' eine cphΛ6308C595S Transkriptionseinheit (T7 Promoter-RBS-cphA) mittels des folgenden PCR-Programms in einem Thermocycler (Modell Primus96 advanced, Fa. Peqlab, Erlangen, Deutschland) amplifiziert . Der Einsatz des 5 ' Primers ermöglichte das Hinzufügen einer 3" Xhol Schnittstelle. Eine 5" Xhol Schnittstelle befand sich bereits Stromabwärts des cphA Gen welches zuvor mittels Ndel/Xhol in den Vektor pET23a kloniert wurde.
Der Ansatz enthält: 10 μl Primer 5\ 10 μl Primer 3\ 10 μl dNTP-MIX (je 2,5 mM) , 10 μl lOfach Pfx-Amplifikationspuffer (Fa. Invitrogen) , 2,5 μl MgSO4 (50 mM) , 10 μl (2 ng) Template DNA (pET23a: :cphA6308) , 0,5 μl Platinum® Pfx-DNA-Polymerase (Fa. Invitrogen), ad 100 μl H2O bidest.
PCR-Programm :
1.) Denaturierung: 2 min 94 0C
2.) Denaturierung: 15 S 94 °C
3. ) Annealing 30 S 55 0C
4.) Elongation 3 min 68 °C
5.) 32fache Wiederholung der Schritte 1.) -4.) 6.) finale Elongation 5 min 68 °C
Das PCR-Produkt wurde mittels GeneClean Kit der Firma Qiagen (QIAquick Gel Extraktion Kit) nach beiliegender Gebrauchsanweisung gereinigt. Anschließend wurde das gereinigte PCR-Produkt mittels Restriktionsenzym Xhol (Fa. Fermentas) nach beiliegender Gebrachsanweisung für 12h bei 37 °C verdaut und das Enzym bei 80 0C für 15 min inaktiviert. Für die Ligation wurde dieses Verdaute Fragment folgendermaßen in den durch Xhol verdaut und linearisierten Zielvektor pCOLADuet-1 : :MVAl-5 ligiert. Entsprechend der Gleichung von DUGAICZYK et al . (1975) kann die einzusetzende Konzentration des Vektors (j) im Ligationsansatz berechnet werden, bei der die theoretische Anfangsgeschwindigkeit von bimolekularer Verknüpfungsreaktion und intramolekularer Zyklisierung gleich groß ist. j (ng/ ml) = 51,1 x Mr-O, 5 x 1.000 Basierend auf dieser Konzentrationsberechnung wurde das zu ligierende DNA-Fragment mit dem 2-4fachen molaren Überschuss an vektorieller DNA ligiert. Der Ligationsansatz bestand aus den zu ligierenden DNA-Spezies und des mitgelieferten Ligase-Puffers in einer Endkonzentration von 1 x. pro μg DNA wurde für die Ligation kohäsiver Enden 1 U eingesetzt. Die Reaktion erfolgte über Nacht bei einer Temperatur von 14,5 0C in einem Peltier-Thermoblock (Firma HLC) . Diese Temperatur stellt somit einen Kompromiss zwischen Stabilität und ausreichender Aktivität des Enzyms dar. Abschließend wurden der Ligationsansatz in E. coli TOPlO transformiert und die auf LB-Kanamycin Platten erhaltenen Klone überprüft (37 0C Inkubation ÜN) . Durch eine Plasmidisolation (Fast Plasmid Mini-Kit; Fa. Eppendorf) einiger Klone und einem Xhol -Verdau wurden vermeintlich positive Klone selektiert. Eine abschließende Sequenzierung mit dem pCOLADuet-1 spezifischen Tl- Terminator Sequenzierprimer (5'-GCTAGTTATTGCTCAGCGG-S') bestätigte die erfolgreiche Ligation von cphA6308C595S . Das so erhaltene Plasmid wurde pCOLADuet-1 : :MVAl-5 : : cphA bezeichnet und ist in Figur 4 dargestellt.
Transformation von pColaDuet-1 : :MVAl-5 : : cphA in E. coli Das Plasmid wurde in den Stamm E. coli HMS174 (DE3) transformiert. Dieser rekombinante Stamm war die Ausgangsbasis für den folgenden ispH knockout und wird im folgenden als „E . coli HMS174 (DE3) pColaDuet-1 : :MVA1- 5 : : cphA" bezeichnet.
Hers tell ung der ispH-Mu tan te von E . coli HMS1 74 (DE3) pColaDuet-1 : :MVAl -5 : : cphA
Es wurde analog der Herstellung der ispH-Mutante von E. coli HMS174 (DE3) pColaDuet-1 : :MVAl-5 verfahren. Der so generierte Stamm wird im Folgenden als „E . coli HMS174 (DE3) AispH ΩFRT/Amp/FRT pColaDuet-1 : :MVAl-5 : : cphA" bezeichnet .
Expression eines weiteren Fremdgens
Die Expression des Fremdgens ist durch die Synthese von Cyanophycin festzustellen. Diese ist eindeutig an Hand der weißen Färbung von expremierenden Bakterien auszumachen. Figur 5 zeigt weiße, opake Bakterienkolonien von E. coli HMS174 (DE3) AispH ΩFRT/Amp/FRT pColaDuet-1 : :MVAl-5 :: cphA. Cyanophycin ist daher ein Beispiel für ein durch das Genprodukt eines Fremdgens synthetisierte Substanz.
Vektorstabilität mit Expression eines weiteren Fremdgens Die verwendeten rekombinanten Stämme von E. coli (E. coli HMS174 (DE3) pColaDuet-1 : :MVAl-5 : : cphA und E . coli HMS174 (DE3) AispH ΩFRT/Amp/FRT pColaDuet-1: :MVAl-5: : cphA) wurden mit 1 % einer 12stündigen Vorkultur (LB-Medium mit entspr. Antibiotika: Rifampizin für E. coli HMS174 (DE3) + Kanamycin für pColaDuet-1 und gegebenenfalls Ampicillin für genomisches Insertionsfragment) inokoliert und in einem 4fach Schikane Klett-Kolben (250 ml Gesamtvolumen mit 100 ml LB-Medium ohne Antibiotika) bei 37 0C und 180 rpm kultiviert. Die Messung oder Optischen Dichte erfolgte aus dem Schikane-Klett-Kolben direkt mit einem Klett Summerson Colorimeter. Zur Bestimmung des Plasmidverlustes wurden die Zellen mit steriler Saline (NaCl 0,9 % in H2O) einheitlich verdünnt und in gleichen Volumina auf LB und LB- Selektionsplatten (mit 50 μg Kanamycin) ausplattiert. Nach einer Inkubation bei 37 0C für 16 h erfolgte die Auszählung der Kolonie-bildenden Einheiten (cfu) hinsichtlich der aufgetretenen Koloniezahlen.
Die hier angeführte Tabelle zeigt Mittelwerte der vergleichenden, quantitativen Bestimmung des Plasmidverlusts nach 70 h in LB-Medium ohne Antibiotika:
Figure imgf000064_0001
Hieraus geht hervor, dass über einen Zeitraum von 72 Stunden bis zu 35 % Plasmidverlust ohne Einsatz des addiction-Systems auftreten.

Claims

Ansprüche :
1. Eine gentechnisch veränderte Zelle, die mindestens eine geänderte Aktivität der im Wildtyp vorhandenen Enzyme aufweist, so dass diese Zelle eine im Vergleich zu ihrem Wildtyp reduzierte Menge an Isopentenyldiphosphat zu bilden vermag, dadurch gekennzeichnet, dass diese Zelle mindestens eine gesteigerte, im Wildtyp nicht vorhandene Enzymaktivität aufweist, durch die diese Zelle eine erhöhte Menge an Isopentenyldiphosphat zu bilden vermag.
2. Eine Zelle gemäß Anspruch 1, dadurch gekennzeichnet, dass mindestens eines der im Wildtyp vorhandenen Enzyme ausgewählt ist aus der Gruppe umfassend:
Ein Enzym Ei, welches die Umsetzung von 1-Deoxy-D- Xylulose-5-Phosphat zu 2-C-Methyl-D-Erythritol- 4-Phosphat katalysiert, ein Enzym E2, welches die Umsetzung von 2-C-Methyl- D-Erythritol-4-Phosphat und Cytidintriphosphat zu 4- (Cytidin-5' -Diphospho) -2-C-Methyl-D- Erythritol katalysiert, ein Enzym E3, welches die Umsetzung von 4- (Cytidin- 5' -Diphospho) -2-C-Methyl-D-Erythritol und ATP zu 2-Phospho-4- (Cytidin-5' -Diphospho) -2-C- Methyl-D-Erythritol katalysiert, ein Enzym E4, welches die Umsetzung von 2-Phospho- 4- (Cytidin-5' -Diphospho) -2-C-Methyl-D- Erythritol zu 2-C-Methyl-D-Erythritol-2, 4- Cyclodiphosphat katalysiert, ein Enzym E5, welches die Umsetzung von 2-C-Methyl- D-Erythritol-2, 4-Cyclodiphosphat zu (E) -4- Hydroxy-3-Methylbut-2-enyldiphosphat katalysiert und ein Enzym E6, welches die Umsetzung von (E) -4- Hydroxy-3-Methylbut-2-enyldiphosphat zu IPP und/oder DMAPP katalysiert
und die im Wildtyp nicht vorhandene Enzymaktivität hervorgerufen wird durch mindestens ein Enzym ausgewählt aus der Gruppe umfassend:
Ein Enzym E7, welches die Umsetzung von
Acetoacetyl-Coenzym A zu 3-Hydroxy-3-
Methylglutaryl-Coenzym A katalysiert, ein Enzym Eg , welches die Umsetzung von 3-Hydroxy-
3-Methylglutaryl-Coenzym A zu Mevalonat katalysiert, ein Enzym E9, welches die Umsetzung von Mevalonat zu Mevalonat-5-Phosphat katalysiert, ein Enzym Ei0, welches die Umsetzung von Mevalonat-
5-Phosphat zu Mevalonat-5-Diphosphat katalysiert und ein Enzym En, welches die Umsetzung von Mevalonat-
5-Diphosphat zu Isopentenyldiphosphat katalysiert .
3. Eine Zelle gemäß Anspruch 1, dadurch gekennzeichnet, dass mindestens eines der im Wildtyp vorhandenen Enzyme ausgewählt ist aus der Gruppe umfassend: Ein Enzym E7, welches die Umsetzung von
Acetoacetyl-Coenzym A zu 3-Hydroxy-3-
Methylglutaryl-Coenzym A katalysiert, ein Enzym E8, welches die Umsetzung von 3-Hydroxy-
3-Methylglutaryl-Coenzym A zu Mevalonat katalysiert, ein Enzym E9, welches die Umsetzung von Mevalonat zu Mevalonat-5-Phosphat katalysiert, ein Enzym Ei0, welches die Umsetzung von Mevalonat-
5-Phosphat zu Mevalonat-5-Diphosphat katalysiert und ein Enzym En, welches die Umsetzung von Mevalonat-
5-Diphosphat zu Isopentenyldiphosphat katalysiert
und die im Wildtyp nicht vorhandene Enzymaktivität hervorgerufen wird durch mindestens ein Enzym ausgewählt aus der Gruppe umfassend:
Ein Enzym Ei, welches die Umsetzung von 1-Deoxy-D- Xylulose-5-Phosphat zu 2-C-Methyl-D-Erythritol- 4-Phosphat katalysiert, ein Enzym E2, welches die Umsetzung von 2-C-Methyl- D-Erythritol-4-Phosphat und Cytidintriphosphat zu 4- (Cytidin-5' -Diphospho) -2-C-Methyl-D- Erythritol katalysiert, ein Enzym E3, welches die Umsetzung von 4- (Cytidin- 5' -Diphospho) -2-C-Methyl-D-Erythritol und ATP zu 2-Phospho-4- (Cytidin-5' -Diphospho) -2-C- Methyl-D-Erythritol katalysiert, ein Enzym E4, welches die Umsetzung von 2-Phospho- 4- (Cytidin-5' -Diphospho) -2-C-Methyl-D- Erythritol zu 2-C-Methyl-D-Erythritol-2, 4-
Cyclodiphosphat katalysiert, ein Enzym E5, welches die Umsetzung von 2-C-Methyl-
D-Erythritol-2, 4-Cyclodiphosphat zu (E) -4-
Hydroxy-3-Methylbut-2-enyldiphosphat katalysiert und ein Enzym E6, welches die Umsetzung von (E) -4-
Hydroxy-3-Methylbut-2-enyldiphosphat zu IPP und/oder DMAPP katalysiert
4. Eine Zelle gemäß Anspruch 1, dadurch gekennzeichnet, dass mindestens eines der im Wildtyp vorhandenen Enzyme ausgewählt ist aus der Gruppe umfassend:
ein Enzym E12, welches die Umsetzung von Mevalonat- 5-Phosphat zu Isopentenylmonophosphat katalysiert und ein Enzym E13, welches die Umsetzung von Isopentenylmonophosphat zu Isopentenyldiphosphat katalysiert,
und die im Wildtyp nicht vorhandene Enzymaktivität hervorgerufen wird durch mindestens ein Enzym ausgewählt aus der Gruppe umfassend:
ein Enzym E10, welches die Umsetzung von Mevalonat-
5-Phosphat zu Mevalonat-5-Diphosphat katalysiert und ein Enzym En, welches die Umsetzung von Mevalonat-
5-Diphosphat zu Isopentenyldiphosphat katalysiert .
5. Eine Zelle gemäß Anspruch 1, dadurch gekennzeichnet, dass mindestens eines der im Wildtyp vorhandenen Enzyme ausgewählt ist aus der Gruppe umfassend:
ein Enzym Ei0, welches die Umsetzung von Mevalonat-
5-Phosphat zu Mevalonat-5-Diphosphat katalysiert und ein Enzym En, welches die Umsetzung von Mevalonat-
5-Diphosphat zu Isopentenyldiphosphat katalysiert,
und die im Wildtyp nicht vorhandene Enzymaktivität hervorgerufen wird durch mindestens ein Enzym ausgewählt aus der Gruppe umfassend:
ein Enzym E12, welches die Umsetzung von Mevalonat- 5-Phosphat zu Isopentenylmonophosphat katalysiert und ein Enzym Ei3, welches die Umsetzung von Isopentenylmonophosphat zu Isopentenyldiphosphat katalysiert .
6. Eine Zelle gemäß mindestens einem der Ansprüche 2 bis 5, dadurch gekennzeichnet, dass für mindestens eines der Enzyme Ei bis Ei3 zutrifft, dass
Ei eine l-Deoxy-D-Xylulose-5-Phosphate- Reductoisomerase (EC 1.1.1.267),
E2 eine 2-C-Methyl-D-Erythritol-4-Phosphat- Cytidylyltransferase (EC 2.7.7.60),
E3 eine 4- (Cytidin-5 ' -Diphospho) -2-C-Methyl-D- Erythritol-Kinase (EC 2.7.1.148), E4 eine 2-C-Methyl-D-Erythritol-2, 4-
Cyclodiphosphat-Synthase (EC 4.6.1.12),
E5 eine 4-Hydroxy-3-Methylbut-2-en-l-yl-Diphosphat- Synthase (EC 1.17.4.3) ,
E6 eine 4-Hydroxy-3-Methylbut-2-enyl-Diphosphat- Reductase (EC 1.17.1.2),
E7 eine Hydroxymethylglutaryl-Coenzym A-Synthase
(EC 2.3.3.1.10) , E8 eine Hydroxymethylglutaryl-Coenzym A-Reduktase
(EC 1.1.1.34) ,
E9 eine Mevalonat-Kinase (EC 2.7.1.36), Eio eine Phosphomevalonat-Kinase (EC 2.7.4.1), En eine Diphosphomevalonat-Decarboxylase (EC
4.1.1.33) ,
Ei2 eine Monophosphomevalonat-Decarboxylase und E13 eine Isopentenylphosphat-Kinase
ist .
7. Eine Zelle gemäß Anspruch 2 oder 4, dadurch gekennzeichnet, dass mindestens eines der Enzyme ist:
E6 Genprodukt des ispH,
E7 Genprodukt des mvaS aus Staphylococcus aureus ,
E8 Genprodukt des mvaÄ aus Lactobacillus lactis oder aus Staphylococcus aureus,
E9 Genprodukt des mvaKl aus Staphylococcus aureus, Eio Genprodukt des mvaK2 aus Staphylococcus aureus und En Genprodukt des mvaD aus Staphylococcus aureus.
8. Eine Zelle gemäß Anspruch 1 oder 2, dadurch gekennzeichnet, dass es sich bei der Zelle um einen nur über den MEP-Weg zur IPP-Synthese befähigten Mikroorganismus handelt.
9. Eine Zelle gemäß Anspruch 3, dadurch gekennzeichnet, dass mindestens eines der Enzyme ist:
Eio Genprodukt des mvaKl,
Ei Genprodukt des ispC,
E2 Genprodukt des ispD,
E3 Genprodukt des ispE,
E4 Genprodukt des ispF,
E5 Genprodukt des ispG und
E6 Genprodukt des ispH.
10. Eine Zelle gemäß mindestens einem der Ansprüche 1, 3, 5 und 9, dadurch gekennzeichnet, dass es sich bei der Zelle um einen nur über den MVA-Weg zur IPP-Synthese befähigten Mikroorganismus handelt.
11. Eine Zelle gemäß mindestens einem der Ansprüche 1 bis
10, dadurch gekennzeichnet, dass die Zelle mindestens eine im Vergleich zu ihrem Wildtyp geänderte?) Aktivität eines Enzyms Ei4, welches die Umsetzung von Isopentenyldiphosphat zu Dimethylallyldiphosphat katalysiert, aufweist.
12. Eine Zelle gemäß mindestens einem der Ansprüche 1 bis
11, dadurch gekennzeichnet, dass die Zelle mindestens ein zusätzliches Fremdgen expremiert.
13. Ein Verfahren zur Herstellung einer gentechnisch veränderten Zelle, umfassend die Verfahrensschritte:
A) Erniedrigung der Aktivität mindestens eines der bereits im Wildtyp vorhandenen Enzyme
E1 bis E6
und
B) Steigerung mindestens einer der nicht im Wildtyp vorhandenen Enyzmaktivitäten von
E7 bis En.
14. Ein Verfahren zur Herstellung einer gentechnisch veränderten Zelle, umfassend die Verfahrensschritte:
A) Erniedrigung der Aktivität mindestens eines der bereits im Wildtyp vorhandenen Enzyme
E7 bis En.
und
B) Steigerung mindestens einer der nicht im Wildtyp vorhandenen Enzymaktivitäten von
E1 bis E6
15. Eine Zelle, erhältlich durch ein Verfahren nach einem der Ansprüche 13 oder 14.
16. Eine isolierte Nukleinsäure pCOLADuet-1 : :MVAl-5 mit der Sequenz nach SEQ ID NO: 3.
17. Verfahren zur Herstellung von Produkten umfassend den Verfahrensschritt des in Kontakt Bringens einer Zelle gemäß mindestens einem der Ansprüche 1 bis 12 und 15 mit einem Nährmedium beinhaltend eine Kohlenstoffquelle unter Bedingungen, unter denen Produkt gebildet wird, sowie gegebenenfalls Aufreinigung des Produktes aus der Kultur.
18. Produkt erhalten nach einem Verfahren gemäß Anspruch 17.
PCT/EP2009/059281 2008-08-18 2009-07-20 Neuartiges, universell einsetzbares addiction-system WO2010020494A1 (de)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE200810041299 DE102008041299A1 (de) 2008-08-18 2008-08-18 Neuartiges, universell einsetzbares addiction-System
DE102008041299.6 2008-08-18

Publications (1)

Publication Number Publication Date
WO2010020494A1 true WO2010020494A1 (de) 2010-02-25

Family

ID=41058967

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2009/059281 WO2010020494A1 (de) 2008-08-18 2009-07-20 Neuartiges, universell einsetzbares addiction-system

Country Status (2)

Country Link
DE (1) DE102008041299A1 (de)
WO (1) WO2010020494A1 (de)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112111410B (zh) * 2018-03-14 2022-06-14 扬州大学 二苯并氧杂环庚酮类化合物的制备方法

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030148479A1 (en) * 2001-12-06 2003-08-07 Jay Keasling Biosynthesis of isopentenyl pyrophosphate
WO2007093962A2 (en) * 2006-02-14 2007-08-23 Firmenich Sa Method for producing terpenes and mep-transformed microorganisms therefore

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US601494A (en) 1898-03-29 Spar for vessels
NL301993A (de) 1962-12-18
US4601893A (en) 1984-02-08 1986-07-22 Pfizer Inc. Laminate device for controlled and prolonged release of substances to an ambient environment and method of use
DE4027453A1 (de) 1990-08-30 1992-03-05 Degussa Neue plasmide aus corynebacterium glutamicum und davon abgeleitete plasmidvektoren
DE4440118C1 (de) 1994-11-11 1995-11-09 Forschungszentrum Juelich Gmbh Die Genexpression in coryneformen Bakterien regulierende DNA
ATE452979T1 (de) 1996-11-13 2010-01-15 Du Pont Herstellungsverfahren von 1,3-propandiol durch rekombinante organismen
JPH10229891A (ja) 1997-02-20 1998-09-02 Mitsubishi Rayon Co Ltd マロン酸誘導体の製造法
DE10031999A1 (de) 1999-09-09 2001-04-19 Degussa Verfahren zur fermentativen Herstellung von D-Pantothensäure unter Verwendung coryneformer Bakterien
US6803218B1 (en) 1999-09-24 2004-10-12 Genencor Intl., Inc. Enzymes which dehydrate glycerol
DE102006010786A1 (de) 2006-03-08 2007-09-13 Westfälische Wilhelms-Universität Münster Mikroorganismus und Verfahren zur Herstellung von 2-Methylzitronensäure

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030148479A1 (en) * 2001-12-06 2003-08-07 Jay Keasling Biosynthesis of isopentenyl pyrophosphate
WO2007093962A2 (en) * 2006-02-14 2007-08-23 Firmenich Sa Method for producing terpenes and mep-transformed microorganisms therefore

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CAMPOS N ET AL: "ESCHERICHIA COLI ENGINEERED TO SYNTHESIZE ISOPENTENYL DIPHOSPHATE AND DIMETHYLALLYL DIPHOSPHATE FROM MEVALONATE: A NOVEL SYSTEM FOR THE GENETIC ANALYSIS OF THE 2-C-METHYL-D-ERYTHRITOL 4-PHOSPHATE PATHWAY FOR ISOPRENOID BIOSYNTHESIS", BIOCHEMICAL JOURNAL, THE BIOCHEMICAL SOCIETY, LONDON, GB, vol. 353, no. 1, 1 January 2000 (2000-01-01), pages 59 - 67, XP001030977, ISSN: 0264-6021 *
CORDIER H ET AL: "Heterologous expression in saccharomyces cerevisiae of an arabidopsis thaliana cDNA encoding mevalonate diphosphate decarboxylase", PLANT MOLECULAR BIOLOGY, SPRINGER, DORDRECHT, NL, vol. 39, 1 March 1999 (1999-03-01), pages 953 - 967, XP002969280, ISSN: 0167-4412 *
KROLL J ET AL: "Establishment of a novel anabolism-based addiction system with an artificially introduced mevalonate pathway: Complete stabilization of plasmids as universal application in white biotechnology", METABOLIC ENGINEERING, ACADEMIC PRESS, US, vol. 11, no. 3, 1 May 2009 (2009-05-01), pages 168 - 177, XP026034668, ISSN: 1096-7176, [retrieved on 20090205] *
PITERA ET AL: "Balancing a heterologous mevalonate pathway for improved isoprenoid production in Escherichia coli", METABOLIC ENGINEERING, ACADEMIC PRESS, US, vol. 9, no. 2, 16 February 2007 (2007-02-16), pages 193 - 207, XP005888126, ISSN: 1096-7176 *

Also Published As

Publication number Publication date
DE102008041299A1 (de) 2010-02-25

Similar Documents

Publication Publication Date Title
US20210230234A1 (en) Maltose dependent degrons, maltose-responsive promoters, stabilization constructs, and their use in production of non-catabolic compounds
US11447804B2 (en) Producing adipate, 6-aminocaproate, hexamethylenediamine or caprolactam in the presence of methanol using a microorganism having increased availability of reducing equivalents
KR102159691B1 (ko) 아세틸-코엔자임 a 유래 화합물을 생산하기 위한 포스포케톨라제 및 포스포트랜스아세틸라제의 용도
CA2886137C (en) Recombinant cell, and method for producing isoprene
EP1383864B1 (de) Isoprenoidproduktion
CN107208118A (zh) 具有提高的能源效率的非天然微生物
MX2014001988A (es) Microorganismos y metodos para producir 2,4 - pentadienoato, butadieno, propileno, 1,3 - butanodiol y alcoholes relacionados.
SG172646A1 (en) Production of isoprenoids
JP2021505154A (ja) 発酵によって（６ｅ）−８−ヒドロキシゲラニオールを生産するための設計された生合成経路
MX2013012871A (es) Produccion de compuestos derivados de acetil-coenzima a.
BR112019020461A2 (pt) variantes de aldeído desidrogenase e métodos de uso
EP3750989A1 (de) Herstellung von pflanzenbasierten aktiven substanzen (z. b. cannabinoide) durch rekombinante mikroorganismen
Gibbons et al. Identification of two genes required for heptadecane production in a N 2-fixing cyanobacterium Anabaena sp. strain PCC 7120
CA2936251C (en) Method of producing a recombinant microorganism
WO2010020494A1 (de) Neuartiges, universell einsetzbares addiction-system
DE102010023749A1 (de) Zelle und Verfahren zur Herstellung von Resveratrol
WO2023044937A1 (en) Genetically modified yeast of the genus yarrowia capable of producing vitamin a
Aldridge An Investigation into a Methane Producing World: The Collective Work in Route to Terpene Production Platforms of Methanosarcina
Pereira Improvement of a photoautotrophic chassis robustness for Synthetic Biology applications
BR112016002526B1 (pt) Método para produção de um composto heterólogo não catabólico, e, composição de fermentação

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09780814

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 09780814

Country of ref document: EP

Kind code of ref document: A1